ID: 1003829664

View in Genome Browser
Species Human (GRCh38)
Location 6:9993838-9993860
Sequence CTGAGAACCAGGGTGTTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 193}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003829664 Original CRISPR CTGAGAACCAGGGTGTTCAC TGG (reversed) Intronic
900524888 1:3123741-3123763 CCGAGAAGCAGGGTGCTCACGGG + Intronic
900529310 1:3144931-3144953 CTGAGGCCCTGGGGGTTCACTGG - Intronic
900917267 1:5647495-5647517 CTGCCAACCAGGGAGCTCACCGG - Intergenic
902041116 1:13493205-13493227 CTGGGAACCTGGGTCTTCCCTGG - Intronic
902621303 1:17652550-17652572 CTGGGGACCAGGGTGTCCTCAGG - Intronic
903070494 1:20724685-20724707 CTGAGGCCCAGGGAGTTCACTGG - Intronic
903213758 1:21832098-21832120 CAGAGAAACAAGGTGATCACAGG - Intronic
903861639 1:26368063-26368085 CTGGGGACCAGGGTGGTCAGAGG - Intronic
904318807 1:29683243-29683265 CCGAGAACCATGGGGTTCTCAGG - Intergenic
905442051 1:38001761-38001783 CTGAGCTCCAGGAGGTTCACTGG - Intronic
908386218 1:63644146-63644168 CTGAGACCCAGGATGTGCCCTGG + Intronic
910541479 1:88363173-88363195 CTGAGAACCAGAGGGGCCACTGG + Intergenic
911565820 1:99462152-99462174 CTGGGAACCAGGGGGACCACTGG + Intergenic
912704461 1:111901768-111901790 TGGAGAACCAGGTTGTCCACAGG + Intronic
914907206 1:151756393-151756415 GTGAGATTCAGTGTGTTCACTGG - Intergenic
916260267 1:162834793-162834815 CTTAGACCCAGGGTATTCTCAGG + Intronic
916427989 1:164699992-164700014 CTGAGAGCCAGGGTGCTCATGGG + Intronic
917610408 1:176683677-176683699 ATGAGAACCAGGGTCATCTCAGG - Intronic
918729433 1:187972558-187972580 CTTAGAATCAGGGGGTACACGGG + Intergenic
920932354 1:210400724-210400746 CTGAAAACCAAGGTGTCTACTGG - Intronic
921950340 1:220923026-220923048 CAGAGAACCAGAGTTTTCATCGG + Intergenic
923533489 1:234830170-234830192 CTAAGAACCATGGAGTTCAAAGG - Intergenic
923555456 1:234997333-234997355 CTCAGGACCAGGATGTTCTCTGG - Intergenic
924096748 1:240559860-240559882 CTGTGAAACATGGTGTTCAGTGG + Intronic
924676139 1:246179896-246179918 CTGAGAGCCAGGGTGAACATGGG - Intronic
924728226 1:246689721-246689743 CTGGGTTCCAGGGTGCTCACTGG + Intergenic
1063299720 10:4840617-4840639 CTGAAGCCCAGGATGTTCACAGG - Intronic
1063309582 10:4939713-4939735 CTCAGAATGAGTGTGTTCACTGG + Intronic
1063317716 10:5022388-5022410 CTCAGAATGAGTGTGTTCACTGG - Intronic
1064672988 10:17734634-17734656 CTGAGAAACAGCTTATTCACGGG - Intergenic
1069247465 10:66224155-66224177 CTGAGAACCAGGGGAGTCAATGG - Intronic
1069729650 10:70602486-70602508 CTGAGGCCCAGGGTGGACACAGG + Intronic
1077196858 11:1285299-1285321 AGGAGAACCAGGGTGACCACAGG + Intronic
1080571266 11:33559174-33559196 CTGAAAACCAGTCTGGTCACGGG - Intronic
1081614282 11:44581310-44581332 CTGAGACTCAGGGTGGTCAAGGG - Intronic
1083785317 11:64942074-64942096 CTGATTATCAGGGTGTTTACTGG - Intronic
1084887488 11:72220740-72220762 CTGGGAACCTGAGTGTTCTCAGG + Intronic
1085719033 11:78897132-78897154 CTGAGCTCCAGGGTTTTTACTGG - Intronic
1087139210 11:94749216-94749238 CTGAGAACCTGGGTAACCACTGG + Intronic
1087603329 11:100343520-100343542 CTCAGAACGCGGGTTTTCACAGG + Intronic
1088127176 11:106442033-106442055 TTGAGAACCAGGGTTTTCAATGG - Intergenic
1088878696 11:113957121-113957143 CTGAGGAGCTGGGTGTTCAGGGG + Intergenic
1089542199 11:119196001-119196023 CTGGGAAACATGGAGTTCACAGG + Intronic
1091917992 12:4282874-4282896 GCCAGAACCAGAGTGTTCACAGG - Intronic
1094304913 12:29007978-29008000 CTGAGAACCAGGGAAGCCACTGG - Intergenic
1096558881 12:52421960-52421982 CTGAGATCCAGGTTGTGCAGAGG - Intergenic
1098773536 12:74584858-74584880 CTGAGAACCACAGAGTTCAAAGG + Intergenic
1098778828 12:74657607-74657629 CTGAAATCCAGTGTATTCACTGG - Intergenic
1102891776 12:116564873-116564895 CAGAAAGCCAGGGTGATCACTGG + Intergenic
1102961804 12:117098409-117098431 CTGTGGACCAGGGTGTGGACTGG - Intronic
1105236957 13:18565673-18565695 CTGAGAACCAGGGGAATCAATGG - Intergenic
1105563824 13:21523126-21523148 CTGAGAACCAGGGGAGTCAATGG - Intronic
1108264086 13:48687147-48687169 CTGAGAACCCGGGGGCCCACTGG - Intronic
1108390843 13:49946073-49946095 CCGAGAACCAGGGGAGTCACTGG - Intergenic
1116723724 14:48533938-48533960 CTGAGAACCTGGGGGACCACTGG - Intergenic
1119408776 14:74415108-74415130 CTGAAAACCAGGGTATTTATTGG - Intronic
1121783112 14:96635199-96635221 CTGAGACCCAGGTTCTTCACTGG + Intergenic
1121920771 14:97878940-97878962 CTGAGGACTGGGGGGTTCACTGG + Intergenic
1123110676 14:105865554-105865576 CTGAGAACCACTGTGCTAACTGG - Intergenic
1124023102 15:25941736-25941758 CTGAGAACCAGGCTGGTGACTGG - Intergenic
1125373100 15:38999773-38999795 CTGAAAACCAGGGCTTTCCCAGG + Intergenic
1127112284 15:55687667-55687689 CTGAAAACCAGAGTTTTCAAGGG - Intronic
1127384791 15:58458682-58458704 CTGAGAAACAGGGAGTTCTTTGG - Intronic
1129064599 15:72890237-72890259 CTGAAAGTCAGGGTGTTCTCAGG + Intergenic
1129777739 15:78247709-78247731 CTAAAAATCAAGGTGTTCACAGG - Intergenic
1132350738 15:101138342-101138364 CGGAGGACTGGGGTGTTCACCGG - Intergenic
1132667443 16:1088704-1088726 CTGAGAACCAGGGTCGCCACTGG + Intergenic
1138600828 16:58053033-58053055 CTGAGAACCAGGGTTCCCTCTGG + Intergenic
1142434921 16:90050181-90050203 CTGAAAACCAGGGTCACCACTGG + Intergenic
1143141235 17:4742923-4742945 CTTAGAACCAGGGTCCTCGCGGG + Intronic
1144772267 17:17766494-17766516 CAGAGACCCAGGGTGCTCTCTGG + Intronic
1146837897 17:36126950-36126972 CTGAGAAGATGGGTGTTCAAAGG - Intergenic
1147582253 17:41634111-41634133 GTGACAACCAGGGTGTCCATGGG + Intergenic
1152193960 17:78905235-78905257 CTGAGAAGCGGGGTGGCCACTGG - Intronic
1152931677 17:83113313-83113335 CTGAGGCCCAGGGTGTCCCCTGG + Intergenic
1153157681 18:2167742-2167764 CTGAGAACCAGGGGAGTCACTGG - Intergenic
1153808298 18:8730014-8730036 CAGAGTAACTGGGTGTTCACAGG - Intronic
1154512587 18:15124242-15124264 CTGAGAACCAGGGGAATCAATGG + Intergenic
1155836293 18:30589139-30589161 CTTAGAAACAGGGGGATCACTGG + Intergenic
1156463696 18:37335691-37335713 CTGAACATCAGGGTTTTCACAGG + Intronic
1157289837 18:46401525-46401547 CTGAGTAGCAGGGTGATCATGGG - Intronic
1158425722 18:57338306-57338328 CTGAAAACCAAGGTGGTAACTGG - Intergenic
1159366915 18:67478310-67478332 CTGAGAACCAGGGAAGTCAATGG + Intergenic
1160861654 19:1239772-1239794 CTGAGAGCCAGGAGGTGCACAGG + Intergenic
1163288329 19:16363357-16363379 CTGGGAGCCAGGGTGCTCTCTGG - Intronic
1166341372 19:42139396-42139418 CTGAGGTCCAGGGAGTTCAGGGG - Intronic
1167561282 19:50227406-50227428 CTCACTACCAGGGTTTTCACTGG + Intronic
1167981365 19:53278956-53278978 CTTAGAACCAGGGTGGTGACTGG + Intergenic
1167984728 19:53304739-53304761 CTTAGGACCAGGGTGGTGACTGG - Intergenic
925082979 2:1084401-1084423 GTGTGAGCCAGGATGTTCACAGG - Intronic
925258432 2:2509244-2509266 CTGAGAACCAGGGGAGTCACTGG + Intergenic
925903884 2:8527664-8527686 CAGAGAGGCGGGGTGTTCACAGG + Intergenic
927465306 2:23332078-23332100 CGGGGAACCAGCATGTTCACCGG - Intergenic
931000363 2:57773661-57773683 CTGAGAACCACTGATTTCACTGG - Intergenic
931094286 2:58921738-58921760 CTGAGGCCCAGAGGGTTCACTGG + Intergenic
931439039 2:62274367-62274389 CTGAGAACCAGGGAAGTCAATGG + Intergenic
931617264 2:64172724-64172746 CTGAAAACCAGGATGGGCACAGG + Intergenic
934581342 2:95442689-95442711 CTGAGAACAAGAGAGTCCACTGG - Intergenic
934598108 2:95634025-95634047 CTGAGAACAAGAGAGTCCACTGG + Intergenic
934988204 2:98902344-98902366 CTGAGAGGCAGGGTCATCACGGG - Intronic
936039225 2:109136895-109136917 CAGAGAATCAGGGAGTTCGCAGG + Intronic
936964144 2:118110516-118110538 CTGAAAACCATGCTGTTCAAGGG + Intronic
937523907 2:122743831-122743853 CTGAGTACCAGAATCTTCACAGG - Intergenic
938512831 2:131968876-131968898 CTGAGAACCAGGGGAATCAATGG + Intergenic
939519725 2:143214561-143214583 TTGAGAACCATGGTATTCACTGG - Intronic
939916402 2:148049169-148049191 CTGAGAACCAGTGAATACACAGG - Intronic
942155118 2:173120373-173120395 CTGAAACCCAGGGGGTTCATGGG - Intronic
944953905 2:204785787-204785809 CTGATAGCCAGGGTCTTCACTGG + Intronic
946462404 2:219880775-219880797 CTGAGGATCTGGGTATTCACAGG + Intergenic
946565583 2:220961072-220961094 CTGAGACCAAGGGTATTCACAGG + Intergenic
947622082 2:231597308-231597330 CTGAGGACCAGGGTGAGCCCTGG - Intergenic
948518120 2:238519101-238519123 CTGAGCAGCAGGGTCTCCACAGG - Intergenic
1172099945 20:32479303-32479325 CAGAGACCCAAGGTGCTCACTGG + Intronic
1172117677 20:32582310-32582332 CTGAGAGCCAGGGTGGAGACTGG + Intronic
1172557400 20:35854052-35854074 CTTAGAAACAGGGTCTTCATCGG - Intronic
1173155726 20:40606936-40606958 CTGAGAAGCAAAGTGATCACGGG - Intergenic
1174661326 20:52215512-52215534 CCTAAAACCAAGGTGTTCACTGG - Intergenic
1175481565 20:59314792-59314814 CTGAGAAGCAGGGAATTCTCTGG - Intronic
1175824525 20:61929853-61929875 CTGAGCACCAGGGTGGGCAGGGG + Intronic
1176780944 21:13193958-13193980 CTGAGAACCAGGGGAATCAATGG - Intergenic
1177978625 21:27883071-27883093 CTGAGAACCAGGGGAATCAATGG - Intergenic
1178230986 21:30784384-30784406 CTGGGAACCAAGGAGTTCAGTGG - Intergenic
1178627839 21:34233178-34233200 CTGAGATCATGGGTGTCCACTGG + Intergenic
1181349218 22:22243523-22243545 CTGAGCAGCTGGGTGTGCACTGG - Intergenic
1181790447 22:25261587-25261609 CTGAGAAGAACTGTGTTCACAGG + Intergenic
1181826249 22:25518628-25518650 CTGAGAAGAACTGTGTTCACAGG + Intergenic
1182143379 22:27981934-27981956 ATGAGAAGCAGGGAGTTCAAAGG + Exonic
1182623737 22:31631275-31631297 CTGAGGACCAGCTTCTTCACTGG + Intronic
1183100176 22:35579016-35579038 CTGAGACCCAGGGAGTCCCCAGG - Intergenic
1183523906 22:38312604-38312626 CTGAGCTCCAGGGTGTCCATAGG + Intronic
1184218891 22:43086453-43086475 CTGATATCCAGGGTGTTCATGGG - Intronic
1184714531 22:46273356-46273378 GGGAGAGCCAGGGTGTCCACTGG - Intronic
1184721640 22:46317953-46317975 CTGAGCACCAGGCAGTGCACAGG - Intronic
1184961624 22:47933492-47933514 CTGAGAACCTGGGGGGCCACTGG - Intergenic
951091011 3:18573852-18573874 CTCAGAACCACAGAGTTCACAGG - Intergenic
951847210 3:27097304-27097326 CTGAAAAACAGGGAGTTAACAGG + Intergenic
952699183 3:36307507-36307529 CTGGGACCCAGGGCATTCACTGG - Intergenic
953430665 3:42837161-42837183 CTGAGAAGCAGGGGGGCCACTGG + Intronic
954278503 3:49558437-49558459 CAGAGAACCTGGTTGTTTACTGG + Intronic
962732208 3:138293729-138293751 CTGAGAGCCAGGTTGTTCACTGG + Intronic
963428443 3:145163118-145163140 CTGAGACCCAAGGTGTTAGCAGG + Intergenic
963556490 3:146795824-146795846 CTGAGAACCAGGATGGCCAATGG + Intergenic
964427109 3:156565508-156565530 CTGAGAACCAGGGAAGTCAGTGG - Intergenic
966148380 3:176838413-176838435 CTGAGAACCCAGAAGTTCACTGG - Intergenic
969297427 4:6278163-6278185 CTGGGGCCCTGGGTGTTCACAGG + Intronic
969297443 4:6278254-6278276 CTGAGGCCCTTGGTGTTCACAGG + Intronic
970077934 4:12246082-12246104 CTGAGAACCAGGGAAGTCAATGG - Intergenic
970878332 4:20898123-20898145 CTGAGAACCAGGATGCCCAAGGG - Intronic
971736385 4:30458391-30458413 CTGAGAACCAGGACTTTCTCAGG + Intergenic
972954384 4:44371043-44371065 CTGAGAACCAGGGAGGCCAATGG + Intronic
976333698 4:83861571-83861593 CTGAGCAGCAGGGTTTTCCCGGG + Intergenic
976960656 4:90967828-90967850 ATGAGAACCTGGGAGTCCACTGG + Intronic
977740233 4:100471471-100471493 CTCAGCACCAGGGTCTTCCCTGG + Intronic
978308723 4:107361888-107361910 CTCAGGACCAGGTTGTTCAGGGG + Intergenic
978362477 4:107946177-107946199 CTGAAAATCAGGATGTTGACAGG + Intronic
978802609 4:112769890-112769912 CTGAGAACCAGGGGTGCCACTGG - Intergenic
981478545 4:145212531-145212553 TTGAGAACCATGGTTTACACAGG + Intergenic
985066435 4:186126676-186126698 CTGAGAACCAGGGGGGTCAATGG - Intronic
986030676 5:3890083-3890105 CTGAGACCCGGAATGTTCACTGG + Intergenic
986501071 5:8400705-8400727 CTGAGATCCATTGTGTTCAGTGG - Intergenic
992034644 5:72760616-72760638 CTGAGAACCTGGGGGGCCACTGG - Intergenic
993125168 5:83825630-83825652 CTGAGAACCAGGATGTCCAATGG + Intergenic
996957721 5:129204749-129204771 CTGTGAATCAGTCTGTTCACAGG + Intergenic
997427190 5:133811446-133811468 CTGAGTCCCAGGGTGTACCCAGG - Intergenic
998812109 5:145976789-145976811 CTGAGAACCATGGGGATAACTGG - Intronic
999692335 5:154158948-154158970 CTGGGAATCAGGGTGTTCAGGGG + Intronic
1000203974 5:159039483-159039505 CTGTGAAGCAGGATTTTCACAGG + Intronic
1000517839 5:162261641-162261663 CTCAGAACCAGAGAGTACACTGG + Intergenic
1002388725 5:178892270-178892292 CTGAGAACAAAGGTGAGCACTGG + Intergenic
1003701113 6:8466307-8466329 GTGAGGACCTGGGTGTTGACTGG - Intergenic
1003829664 6:9993838-9993860 CTGAGAACCAGGGTGTTCACTGG - Intronic
1005151271 6:22754108-22754130 CTGAGGACCAGGGGGAACACTGG - Intergenic
1006511287 6:34522718-34522740 CTGAGAACCAGGGGGGCCATGGG + Intronic
1007256768 6:40535187-40535209 CTGAGACCCAGAGGGATCACAGG - Intronic
1018287895 6:162260242-162260264 ATGAGAAACAGGGTGATCAGAGG + Intronic
1022226090 7:28365016-28365038 CTGAGATTCAGGGTGTTGAATGG - Intronic
1023385042 7:39648200-39648222 CTGAAAACCATGGTCTTCAGAGG + Intronic
1024054469 7:45651114-45651136 CTGATTACCAGAGTGTTCCCAGG + Intronic
1024814501 7:53253195-53253217 CTGAGAACCAGGGGAGCCACTGG + Intergenic
1029282930 7:99448303-99448325 CTGAGAACCAGGGTGCAGAGGGG + Intronic
1033718304 7:144026421-144026443 CTGAGAACCTGGGGGTCCAGGGG - Intergenic
1034416555 7:150968170-150968192 CTGAGAAGGAGGGTGATGACAGG + Intronic
1037988013 8:23301824-23301846 CTGAGAAATAGGGCGTGCACAGG - Intronic
1038415486 8:27391912-27391934 CTCAGAGCCAGGGTTTTCACTGG + Intronic
1040593610 8:48818122-48818144 CTGAGGACCACGGTGTGCACAGG + Intergenic
1043957598 8:86379506-86379528 CTCTGATCTAGGGTGTTCACAGG + Intronic
1044411143 8:91884692-91884714 CTGATAAGCAGTGAGTTCACAGG - Intergenic
1045509878 8:102806257-102806279 CTGGGACCCAGGGTGTCCAAAGG + Intergenic
1047201478 8:122771258-122771280 ATGAAAACCAAGGTGTCCACAGG + Intergenic
1049416285 8:142497135-142497157 CTGAGGCCCAGAGTGCTCACTGG + Intronic
1049696791 8:143987982-143988004 CTGAGCATCAGGGTGTGCAGGGG - Intronic
1050634157 9:7592537-7592559 CTGAGAACAAGAGTGCTCAGTGG + Intergenic
1052601245 9:30635208-30635230 CTGGGAAACAGGGTTTTCATTGG - Intergenic
1055440036 9:76328218-76328240 CTGAGAAGAAGGCTGTTCATGGG - Exonic
1057131312 9:92656254-92656276 CTGAGAAGCATGGGGTTCAGAGG - Intronic
1057196251 9:93116855-93116877 GGGAGAACCCGGCTGTTCACTGG + Intergenic
1057498648 9:95579612-95579634 CTGAGAACCAGGGAGGCCACTGG - Intergenic
1061224053 9:129270320-129270342 TTGATCACCAGGATGTTCACTGG - Intergenic
1061359578 9:130132429-130132451 GAGAGAACCAGGGTGGACACAGG - Intronic
1062064520 9:134519017-134519039 CTGAGGACCAGGGTCTTGTCTGG + Intergenic
1062195018 9:135268204-135268226 CTGAGAGGCAAGGAGTTCACCGG - Intergenic
1062504340 9:136865702-136865724 CAGAGAACCAGGGTGGGCACTGG - Intronic
1062724025 9:138061121-138061143 CTGGGAATCAGGGGCTTCACTGG - Intronic
1185631514 X:1518948-1518970 CTGAGGACCAGGGAGATTACTGG - Intronic
1186230346 X:7446871-7446893 CTGAGAATCAAGCTGTTCTCTGG - Intergenic
1188180481 X:27049363-27049385 CTGAGAACCCAGGGGGTCACTGG - Intergenic
1190507117 X:51137197-51137219 CTGAGAACCTGGGGGTCCATGGG + Intergenic
1195500723 X:105595456-105595478 CTGACAACCAGGGTTTTCCATGG + Intronic
1196432653 X:115643473-115643495 CAGAGAACCAGGATATTGACTGG + Exonic
1198305551 X:135379301-135379323 CTGAGAATCTGGGTGGGCACTGG - Intergenic
1198331249 X:135625028-135625050 GTGTGAACCATGTTGTTCACGGG + Intergenic
1198335090 X:135658100-135658122 GTGTGAACCATGTTGTTCACGGG - Intergenic
1199572301 X:149279214-149279236 CTGAGAACCAGGGGAGTCAATGG - Intergenic
1199672002 X:150155422-150155444 CTGAGCACCAGGCTGCTCAGAGG + Intergenic
1200153863 X:153964917-153964939 GCGAGAAGCAGGGTGGTCACAGG - Intronic
1201934937 Y:19400002-19400024 CTCAGAACTAGAGTATTCACAGG + Intergenic