ID: 1003832144

View in Genome Browser
Species Human (GRCh38)
Location 6:10023180-10023202
Sequence TCAAGGGCGTGGTGGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 323}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003832144_1003832151 -7 Left 1003832144 6:10023180-10023202 CCTCCTTCCCACCACGCCCTTGA 0: 1
1: 0
2: 3
3: 21
4: 323
Right 1003832151 6:10023196-10023218 CCCTTGACCATTCAAGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003832144 Original CRISPR TCAAGGGCGTGGTGGGAAGG AGG (reversed) Intronic
900135187 1:1114159-1114181 GCAAGGCCGTGGGGGGAGGGGGG - Intronic
900178740 1:1302251-1302273 TCAAGGGCCAGGTGGGACAGAGG - Intronic
901026366 1:6280659-6280681 TGAAGGGCCTGCTGGGAAGCTGG - Intronic
902863159 1:19260289-19260311 CCAAGGGCGTGGTGAGAAGTGGG - Intergenic
903617670 1:24673573-24673595 TCAGGGGCGGGGTGGGGGGGGGG + Intergenic
903673339 1:25049501-25049523 GCAAGGGGGTGCTGGGAAGATGG - Intergenic
904593089 1:31626193-31626215 TCAAGGGGGAGGAGGGAAGGAGG - Intronic
906078771 1:43070054-43070076 TCTGGGGAGTGGTGGGAGGGAGG - Intergenic
906262733 1:44406219-44406241 TGAAGGGTGTGGAGGGAGGGAGG + Intronic
906508981 1:46400517-46400539 TGCAGGTGGTGGTGGGAAGGAGG + Intronic
906534233 1:46543008-46543030 TCAAGGTGGGGGTGGGGAGGGGG - Intergenic
907783145 1:57585705-57585727 TGAATGGGGAGGTGGGAAGGGGG - Intronic
907847296 1:58220481-58220503 GCAAGGGGCTGGGGGGAAGGTGG + Intronic
910884352 1:91949789-91949811 TCAAGGGAGGGCTGGGAAGGAGG + Intronic
911058854 1:93730809-93730831 TCAAGGGAGGTGGGGGAAGGAGG - Intronic
912380659 1:109246454-109246476 CCAATGGCCTGCTGGGAAGGAGG - Intergenic
912506232 1:110158420-110158442 TCCAGGGCGTTGTGGGATGTGGG + Intronic
912654924 1:111477622-111477644 TGAAGGGTGGGGTGGGGAGGAGG - Intronic
913098776 1:115544288-115544310 GCCAGGGAATGGTGGGAAGGAGG + Intergenic
913274668 1:117125254-117125276 TCAAGGGGGTAGTGTGAAGTAGG - Intergenic
914814747 1:151055217-151055239 CTAAGGGCCTGGTGGGAAGAGGG + Intronic
916261861 1:162850409-162850431 TCAAAATAGTGGTGGGAAGGTGG + Intronic
916474147 1:165152673-165152695 TACAGGGCATGGTGGGAATGGGG - Intergenic
916773454 1:167936234-167936256 TCGAGGGCATGGGGAGAAGGAGG - Intronic
917979462 1:180260041-180260063 CCAAGGGTGTGGTGGGAGTGAGG + Intronic
918143566 1:181737474-181737496 GCATGGGCGTGGTGGGGAGTGGG + Intronic
921265311 1:213416799-213416821 TCAAGGGCATGGCAGGAAGAGGG - Intergenic
922775692 1:228213370-228213392 ACGACGGCGGGGTGGGAAGGGGG - Intronic
922968742 1:229716205-229716227 TCAGGGGCCTGTTAGGAAGGAGG - Intergenic
924057658 1:240139744-240139766 TGTAGGGTGTGGTGGGAAGATGG + Intronic
1063260981 10:4389228-4389250 TTACGGGCGTGGTGGGGAGGTGG + Intergenic
1067558750 10:47289805-47289827 TCTAGAGACTGGTGGGAAGGAGG - Intergenic
1068939993 10:62671257-62671279 GCAAGGAAGTGGTGGGAAGAAGG + Exonic
1069944221 10:71974838-71974860 GGAAGGGAGTGGTGGGAAGGTGG - Intronic
1070216963 10:74395260-74395282 GCAAGGTCGTGGTGGAGAGGGGG - Intronic
1070788409 10:79175664-79175686 TGAAGGGTGTGGTGGCCAGGGGG - Intronic
1071712202 10:88060819-88060841 TCAAGGGGGTGGTGGCAAGGTGG + Intergenic
1072311135 10:94156561-94156583 ACAAGGAGGTGCTGGGAAGGTGG - Intronic
1074321886 10:112410899-112410921 TCAAGAGAGTGGTGGGTTGGTGG - Intronic
1074610507 10:115016829-115016851 TGGAGGGGGTGGTGGGAAGCTGG + Intergenic
1074986783 10:118666455-118666477 TTGAGGGCCTGGTGTGAAGGAGG - Intergenic
1075074745 10:119343198-119343220 CCAAGGGCGGGGTGGGGAAGGGG + Intronic
1075101555 10:119509926-119509948 TCCAGGGAGTGATGGGCAGGGGG + Intronic
1075103742 10:119523827-119523849 TTAATGGAGTGGTTGGAAGGAGG - Intronic
1075710226 10:124526835-124526857 TCCAGTGTGTGGTGGGGAGGTGG + Intronic
1076440453 10:130477595-130477617 TCAAGTGCCTGCTGGGAAGAGGG - Intergenic
1077162303 11:1119398-1119420 ACAAGGGCGAGGAGGGGAGGGGG - Intergenic
1077227511 11:1444831-1444853 GCAAGTGAGTGGGGGGAAGGTGG - Intronic
1078627115 11:12967848-12967870 TCAAGTCCATGGTGGGAAGAGGG + Intergenic
1079101367 11:17544208-17544230 TCCTGGGCGCGGTGGGTAGGGGG - Intronic
1079194205 11:18310881-18310903 TCAAGAGCGTCGTGGGAAACCGG - Exonic
1079229130 11:18634418-18634440 TATAGGCCGTGGAGGGAAGGGGG - Exonic
1079362457 11:19780354-19780376 ACTAGGGTGTGGAGGGAAGGTGG - Intronic
1079469027 11:20760552-20760574 TCAAGGGCATGGATGGAAGAAGG + Intronic
1081877735 11:46421457-46421479 TCTAGTGCGGTGTGGGAAGGAGG + Intronic
1083031551 11:59597411-59597433 TGAAGGGAGTAGTGGGAAAGTGG - Intronic
1085039757 11:73319974-73319996 TCCAGGGCAAGGAGGGAAGGTGG + Intronic
1086959427 11:92967559-92967581 TCAGGGGCCTGGTGAGAAGATGG - Intergenic
1089542582 11:119198801-119198823 TTCAGGCCGTGATGGGAAGGGGG + Intergenic
1089694202 11:120206637-120206659 TCAAGGGTGTGGTGGGAAAGTGG - Intergenic
1090290052 11:125535347-125535369 TCCAGGCCATGATGGGAAGGGGG + Intergenic
1091275434 11:134346419-134346441 ACATGGGCGGGGTGAGAAGGGGG - Intronic
1091781042 12:3214884-3214906 TCAGGGGGATGGGGGGAAGGAGG - Intronic
1091934414 12:4423774-4423796 TTAAGGATGTGGTGAGAAGGTGG + Intergenic
1092180178 12:6441526-6441548 TCAAAGCCTTGCTGGGAAGGAGG + Intergenic
1092205611 12:6612985-6613007 TCTAGGGAGGGGTGGGGAGGGGG - Intergenic
1094183687 12:27618310-27618332 TTTAGGCCGTGATGGGAAGGGGG + Intronic
1094725760 12:33114085-33114107 TCGAGGGAGTGGTGGGAAGAGGG + Intergenic
1095750487 12:45705263-45705285 TAAAGGGGGTGGTGGGATTGAGG - Intergenic
1095864469 12:46956584-46956606 TCAATGGAGTGGTGTGGAGGAGG - Intergenic
1096530654 12:52240918-52240940 TCGGGGGCGTGGGGGGAGGGGGG - Intronic
1096966901 12:55635745-55635767 TGCAGGACGTGGTGGGGAGGTGG - Intergenic
1096984919 12:55749939-55749961 TCTAGGGCTTGGGGGGATGGGGG - Exonic
1101345335 12:103880941-103880963 GCAGGGGAGTGGAGGGAAGGGGG - Intergenic
1102059770 12:109923643-109923665 GCAGGGGTGTGGTGGGAGGGAGG - Intronic
1102454655 12:113064027-113064049 TCAAGGGAGAAGGGGGAAGGGGG - Intronic
1103067273 12:117909938-117909960 GCAAGGGCATGGTGGCATGGTGG + Intronic
1103163402 12:118749836-118749858 TCAACAGCGGGGTGGGGAGGCGG + Intergenic
1103222809 12:119259969-119259991 TTAAGTGCGTGGTAGGAAGGGGG - Intergenic
1104299255 12:127549331-127549353 TCCAGGGAGAGGTGGGCAGGAGG + Intergenic
1105985577 13:25562952-25562974 TCAACAGTGTGCTGGGAAGGTGG - Intronic
1106506651 13:30376342-30376364 ACAAGGATGTGGAGGGAAGGGGG + Intergenic
1107574059 13:41697815-41697837 TGAAGGGGGTGGTGAGAAGCAGG - Intronic
1107665935 13:42690639-42690661 TCAAGGGAAGCGTGGGAAGGGGG - Intergenic
1108453896 13:50594563-50594585 GCAAGGCAGTGGCGGGAAGGCGG + Intronic
1109410678 13:61963796-61963818 TCAGGGGGTTGGTGGGAGGGTGG + Intergenic
1110355060 13:74558078-74558100 TCAAGGGTGAAGAGGGAAGGAGG - Intergenic
1111847892 13:93534525-93534547 TGAGTGGCGTGGTGGGAAAGAGG - Intronic
1112579923 13:100669784-100669806 TCCAGGATGTGGTGGGAATGGGG - Intronic
1114513846 14:23285221-23285243 TCAAGTGTATGATGGGAAGGAGG + Intronic
1118009776 14:61598662-61598684 TCAAGGACATGGTGGGTGGGGGG - Intronic
1118294812 14:64559168-64559190 TCCACTGGGTGGTGGGAAGGAGG + Intronic
1118664323 14:68050298-68050320 TCAAGGGGGTGATGGGGAAGAGG - Intronic
1119686879 14:76640163-76640185 TCAAGAGCTTGGCAGGAAGGGGG - Intergenic
1120604246 14:86552962-86552984 TGGAGGGTGTGGTGGGAGGGGGG + Intergenic
1121341461 14:93107626-93107648 TCAAGGGCCTGGAGGGGTGGGGG + Intronic
1121619721 14:95337699-95337721 TCAAGAGCCTGTAGGGAAGGTGG - Intergenic
1121876293 14:97456527-97456549 TCAAGGGCAGGGTGGCACGGTGG + Intergenic
1121879933 14:97490856-97490878 TCAAGGGCGGGATGGAATGGAGG + Intergenic
1122196024 14:100086523-100086545 TCCAGGGCGTAGTAGGAAGACGG + Intronic
1122505444 14:102228950-102228972 TGTTGGGCGTGGTTGGAAGGTGG - Exonic
1123493432 15:20800215-20800237 TCCAGTGCGCGGTGGGACGGCGG - Intergenic
1123549941 15:21369317-21369339 TCCAGTGCGCGGTGGGACGGCGG - Intergenic
1124656978 15:31516690-31516712 TAAAGGAAGTGGTGGGAAAGTGG - Intronic
1126405162 15:48315695-48315717 TTAAGGGTGGGGTGGGGAGGGGG + Intergenic
1126619565 15:50623488-50623510 TCCAGGGCGGGGCGGGGAGGGGG - Intronic
1127468158 15:59265316-59265338 CCAAGGGATTGGTGGGGAGGTGG - Intronic
1128045392 15:64613417-64613439 ACAAGAGCTTTGTGGGAAGGAGG + Intronic
1128849299 15:70935847-70935869 ATAAGGGTGTGGTGGGAAGGTGG - Intronic
1132145248 15:99425587-99425609 TAGAGGGCAAGGTGGGAAGGAGG + Intergenic
1132357000 15:101179304-101179326 TCACAGGCGTAGTGGGACGGGGG - Intronic
1202958270 15_KI270727v1_random:96535-96557 TCCAGTGCGCGGTGGGACGGCGG - Intergenic
1132665763 16:1080667-1080689 CCAGGGGCGAGGTGGGGAGGCGG + Intergenic
1133345329 16:5065994-5066016 GCCAGGGGGAGGTGGGAAGGAGG - Exonic
1135142659 16:19934953-19934975 TCATGGGGGTTGTGGGGAGGTGG + Intergenic
1135982266 16:27157072-27157094 TCAAGGCCGTGATGGAAAGAGGG + Intergenic
1136240290 16:28939076-28939098 CCTAGGGCCTGGTGGGCAGGGGG + Intronic
1137476886 16:48817086-48817108 TCATGGGCCAGGAGGGAAGGTGG + Intergenic
1137493241 16:48950545-48950567 TCAAGGGCAAGATGGGATGGGGG - Intergenic
1137570006 16:49559080-49559102 TCCAGGGGATGGTGAGAAGGTGG - Intronic
1139869145 16:70090108-70090130 TCAAAGGGGTGGTGGCAGGGAGG - Intergenic
1140074679 16:71686592-71686614 GCCAGGGCATGGTGGGGAGGGGG - Intronic
1140386237 16:74542029-74542051 TCAAAGGGGTGGTGGCAGGGAGG + Intronic
1141609933 16:85175559-85175581 TCACGGGGGCGGGGGGAAGGGGG - Intronic
1142024407 16:87804758-87804780 GCAGGGTCGTGGTGGGAACGTGG - Intergenic
1142325057 16:89409359-89409381 ACAGGGGTGGGGTGGGAAGGCGG + Intronic
1142863100 17:2775474-2775496 TTAAGTGGGTGGTGGGGAGGGGG + Intergenic
1143022559 17:3924415-3924437 TCATGGGTGTCGTGGGGAGGGGG + Intronic
1143582415 17:7834864-7834886 GCAGGGGGGTGGTGGGAAGAAGG - Intergenic
1143659341 17:8315165-8315187 TCCAGGGGGTCGTGGGAAGGTGG - Exonic
1146902961 17:36600218-36600240 TGAAGGGTGGGGAGGGAAGGAGG - Exonic
1147214413 17:38890924-38890946 TGAAGGGCAAGGTGTGAAGGGGG + Intronic
1147325512 17:39667797-39667819 TCTGGGGCGGGGTGGGGAGGGGG + Intergenic
1148060539 17:44832994-44833016 TCAAGGGGGAGGAGAGAAGGGGG - Intergenic
1148387719 17:47246872-47246894 TCCAGGGATTGGAGGGAAGGAGG + Intergenic
1151464544 17:74276095-74276117 CCAAGGGAGTGATGGGGAGGAGG - Intronic
1151522430 17:74640018-74640040 TCATGGGCGTGGTGAGGTGGGGG - Intergenic
1152564451 17:81093931-81093953 TCACGGGGGTGGTGGGGGGGAGG - Intronic
1154450983 18:14474753-14474775 TCCAGTGCGCGGTGGGACGGCGG - Intergenic
1154465703 18:14641507-14641529 TAAAGAGCGTGGTGAGCAGGAGG - Intergenic
1156267108 18:35498764-35498786 TTAATGGGGTGGTGGGGAGGTGG - Intergenic
1157703318 18:49779348-49779370 TCAGGGAAGTGGTGGGAAGCCGG + Intergenic
1159016425 18:63104890-63104912 TCATGGGGGCGGTGGGAACGAGG + Intergenic
1160949194 19:1657625-1657647 TCAAGGGAGAGGCGTGAAGGGGG + Intergenic
1162030334 19:7914505-7914527 GGCAGGGCGAGGTGGGAAGGGGG + Intergenic
1162572500 19:11481240-11481262 GCAAGGGCCTCGAGGGAAGGAGG - Intronic
1163565458 19:18048525-18048547 TCATGGGGGTGGTGGGCATGAGG - Intergenic
1163765794 19:19162638-19162660 CCCAGGGAGAGGTGGGAAGGAGG - Intronic
1165495459 19:36150072-36150094 TGCAGGGCCTGGTGGGAATGGGG - Exonic
1165617921 19:37218369-37218391 TAGAGGGGGTGGTGGGGAGGCGG + Intronic
1166616229 19:44249866-44249888 TCTAGGGGGTGGAGGGGAGGTGG - Intronic
1168086240 19:54049330-54049352 GGAAGGGCCTGGTGGGAAAGTGG + Intronic
1168344408 19:55643418-55643440 TCGGGGGCGTGGGCGGAAGGGGG - Exonic
1202637126 1_KI270706v1_random:52257-52279 TCAGTAGGGTGGTGGGAAGGTGG - Intergenic
926659791 2:15452101-15452123 CCAAGGGCTAGGTGGGAAGATGG + Intronic
926669264 2:15561002-15561024 TCTAGGGCGGGGTGGGGTGGTGG - Intronic
927417466 2:22893773-22893795 ACAAGGGTGAGGTGGGGAGGAGG + Intergenic
927611473 2:24545545-24545567 TCAAGGGGGTGGTAGGAGGTGGG - Intronic
928115347 2:28542153-28542175 TGAAGAGTGTGGTGGGGAGGAGG + Intronic
928428782 2:31200853-31200875 TAAAGGAAGTGGTGGGAAAGAGG - Intronic
928499890 2:31879956-31879978 TTAAGGGAGTGGTGGGATGTGGG - Intronic
930653903 2:53989574-53989596 TCTAGGTCTTGGTGGGAAGTAGG + Intronic
932448516 2:71795042-71795064 AGAAGGGGGTGCTGGGAAGGTGG + Intergenic
933507585 2:83198744-83198766 TAAAGGAAGTGGTGGGAATGTGG - Intergenic
934877886 2:97942322-97942344 TCAATGGGGTGGGGGGAGGGGGG + Intronic
939054436 2:137346504-137346526 TCAAGGGCATGTTGGGGAGAGGG - Intronic
939914383 2:148021218-148021240 TCAGGGGGGTGGGGGGAAGGCGG + Intronic
942799454 2:179860262-179860284 TCATGGGCGTGGGGAGAGGGGGG + Intronic
943198841 2:184792921-184792943 GCTAGGGGGTGGTGGGAAGGAGG - Intronic
943397801 2:187363325-187363347 TCAAGGGCCTAATGGGAAAGGGG - Intronic
945152207 2:206803298-206803320 TCCAGGGCCAGGTGGGGAGGAGG - Intergenic
945780480 2:214165622-214165644 TCAAGGGGGTGGGGGGCAGTGGG - Intronic
945976805 2:216277499-216277521 TCAAGGGGTGGATGGGAAGGGGG - Intronic
946227054 2:218269732-218269754 CCAAGGGGATGATGGGAAGGGGG + Intronic
946397650 2:219451363-219451385 CCAAGGGAGGGGTGGGAAAGAGG + Intronic
948126419 2:235567666-235567688 TCTAGGGAGTGGTGGGGAGAAGG + Intronic
948269851 2:236665937-236665959 CCGAGGGCGTGGTGGGAAGGGGG - Intergenic
948667177 2:239543865-239543887 TTGAGGGTGTGGTGGGGAGGTGG - Intergenic
948717969 2:239877871-239877893 TTCAGGCTGTGGTGGGAAGGTGG - Intergenic
948993111 2:241564562-241564584 TCAGGGGCCGGGTGGGCAGGGGG + Intronic
1170208419 20:13823978-13824000 TCAAGGGTATGGTGGAAGGGAGG - Intergenic
1172311322 20:33920575-33920597 TGAAGTGCCTGGTGGGAGGGTGG - Intergenic
1172604506 20:36205645-36205667 TCAAGTGCCTGATGGGAAGAGGG + Intronic
1172913885 20:38429644-38429666 TCTAAGACGTGGTGGGAGGGAGG + Intergenic
1173726409 20:45301285-45301307 TCCAGGGTGTGGTGGGAGGGTGG + Intronic
1174188221 20:48721962-48721984 TGGAGGGGGTGGTGGGGAGGTGG + Intronic
1174296813 20:49551243-49551265 TTCAGGCCGTGGTGGGAAGTGGG + Intronic
1175725828 20:61317732-61317754 TCTCGGGCATGGTGGAAAGGGGG - Intronic
1175763156 20:61574651-61574673 ACAAGGGCTTTGTGGGGAGGTGG - Intronic
1175820454 20:61906387-61906409 TTAAGGGCTTGGTGGGATGAAGG - Intronic
1175912320 20:62410814-62410836 TCCAGGCCCTGGTGGGCAGGTGG + Exonic
1176445254 21:6815820-6815842 TCCAGTGCGCGGTGGGACGGCGG + Intergenic
1176823421 21:13680853-13680875 TCCAGTGCGCGGTGGGACGGCGG + Intergenic
1176968030 21:15233600-15233622 TCATGGGGGTGGAGGGGAGGGGG + Intergenic
1179428712 21:41304055-41304077 GGAAGGGCGCGGTGGGAAAGGGG + Intergenic
1180705701 22:17808541-17808563 TAAATGGTGGGGTGGGAAGGAGG + Intronic
1181618012 22:24068205-24068227 AGAAGGGGGTGGAGGGAAGGAGG + Intronic
1182007671 22:26974841-26974863 TGGAGGGAGGGGTGGGAAGGTGG + Intergenic
1183201471 22:36387998-36388020 CCGAGGGCGGGGCGGGAAGGCGG - Exonic
1183296106 22:37030448-37030470 TCCAGGTCGTGATGGGCAGGGGG - Intergenic
1183371011 22:37432413-37432435 TGAAGGGAGTGGGGGGAAGGAGG - Intergenic
1183641639 22:39096382-39096404 TCAGTGGGGTGGTGGGGAGGGGG + Intergenic
1184404739 22:44293406-44293428 TCACCGGGGTGGTGGGGAGGAGG + Intronic
1184535213 22:45082096-45082118 GGAAGGGCATGCTGGGAAGGGGG + Intergenic
1184765357 22:46569353-46569375 TGAAGGGGATGGTGGGAGGGAGG + Intergenic
949791385 3:7796363-7796385 TCAAGGAGGTGGTGGGGATGTGG - Intergenic
950053226 3:10007632-10007654 TGGAGGGGGTGGTGGGAATGGGG + Intronic
950097308 3:10337745-10337767 CCCAGGGCGTGGTGGTCAGGGGG - Intronic
950304878 3:11909947-11909969 TGGAGGGGGTGGTGGGAATGAGG + Intergenic
950617069 3:14168450-14168472 TCAAGGTTCTGCTGGGAAGGAGG + Intronic
951217934 3:20041287-20041309 GAAAGCGCGGGGTGGGAAGGTGG + Intronic
951708263 3:25565812-25565834 TGGTGGGCTTGGTGGGAAGGAGG - Intronic
953610342 3:44442652-44442674 CCAAGGGAGTGGGGGAAAGGTGG + Exonic
954103145 3:48393363-48393385 TTCAGGGCCTGGTGGGGAGGGGG + Intronic
954109626 3:48426773-48426795 CCAAGGGGGCGGGGGGAAGGGGG + Intronic
954688160 3:52381846-52381868 TCCAGGGCGTGCTGGGCAGTGGG + Intronic
955555011 3:60127427-60127449 TCCAGGGCTGGGTGGAAAGGGGG - Intronic
958691359 3:97471697-97471719 TCAAGGGAAGGGTGGGAATGTGG + Intronic
960664009 3:120093301-120093323 TTAAGGGCGAGGTGGAAAAGGGG + Intronic
960853529 3:122079778-122079800 TCAGGGCCGTGATGGGGAGGTGG - Intronic
961380208 3:126492091-126492113 GTGAGGGGGTGGTGGGAAGGAGG - Intronic
962292038 3:134145410-134145432 TCAGGGGAGTGGAGGGCAGGGGG + Intronic
963601126 3:147379957-147379979 TTGAGGGCGTGGTGTGAAGTGGG + Intergenic
964087402 3:152834978-152835000 TCCAGGGCGCAGTGGGAAGCAGG - Exonic
966314095 3:178625472-178625494 TCAATGCCGGGGTGGGGAGGTGG + Intronic
967543252 3:190693575-190693597 TCCAGGCCATGATGGGAAGGGGG + Intergenic
967596395 3:191329929-191329951 TCAAGGGGGTGGTTGGGGGGGGG + Intronic
968250378 3:197205173-197205195 GAAAGGGCGTGGGAGGAAGGGGG + Intronic
969300175 4:6292893-6292915 TCACGGGCCCAGTGGGAAGGTGG - Intronic
970252675 4:14132587-14132609 TAAAGTGAGTGGTGGGAAGAGGG + Intergenic
970284618 4:14496179-14496201 TCAAGGGAGTGGAGGGGAGGTGG + Intergenic
970588418 4:17536870-17536892 TCAAGGGAGTAGGAGGAAGGAGG + Intergenic
973331814 4:48916987-48917009 TCCAGGGGTTGGGGGGAAGGAGG - Intergenic
973773548 4:54226886-54226908 TCCGGGGCGTCGGGGGAAGGTGG - Intronic
975584932 4:75940328-75940350 TCCCGGGAGTGGGGGGAAGGGGG + Intronic
976897349 4:90128007-90128029 TTGCGGGCGGGGTGGGAAGGAGG + Intronic
977726531 4:100302782-100302804 TCCAGAGCATGGAGGGAAGGCGG - Intergenic
978119324 4:105059583-105059605 TCAAGAGTGGGGTGGGAATGGGG + Intergenic
980810301 4:137868828-137868850 TCAAGGAAATGGTGGGAAGGGGG - Intergenic
981546870 4:145902765-145902787 TGCTGGGCGTGGTGGGAAGGCGG + Exonic
981598111 4:146449967-146449989 TCAAAGGAGGGGTGGGAATGGGG + Intronic
982398530 4:154940177-154940199 ACCTGGGCTTGGTGGGAAGGAGG + Intergenic
984020184 4:174475651-174475673 TTAGGGGTGTGATGGGAAGGTGG + Intergenic
990509918 5:56480970-56480992 ACAGGGGCGGGGTGGGGAGGGGG + Intronic
990882345 5:60553989-60554011 TCAACGGGGGGGTGGGCAGGAGG - Intergenic
992979799 5:82157076-82157098 TCAAGGGCGAGGCAGGAGGGAGG - Intronic
993418062 5:87660003-87660025 TCCAGGGCGGGGCGGGAAAGGGG + Intergenic
994347760 5:98707460-98707482 TCAAGGAAAAGGTGGGAAGGGGG + Intergenic
998603618 5:143610738-143610760 TGAGGGGAGAGGTGGGAAGGGGG + Intergenic
999233061 5:150073642-150073664 TGAAGGGGGTGGTGAGAAGAGGG - Intronic
999247817 5:150164676-150164698 TCAAGGGATTGGTGGGAAACTGG - Intergenic
999453692 5:151697538-151697560 TCCAGGGCTCTGTGGGAAGGGGG + Intergenic
1000039958 5:157478218-157478240 TCCAGGGTCTGGTGGGGAGGAGG - Exonic
1001531636 5:172466240-172466262 TCAAGTGCGGGCTGGGAACGTGG + Intergenic
1001537268 5:172507043-172507065 TGAAGGGCCTGGTGGGGAGTTGG - Intergenic
1002451448 5:179321352-179321374 GCAAGGGAGTGGAGGGAAGCTGG - Intronic
1002984277 6:2173442-2173464 TACAGGGCATGGAGGGAAGGAGG + Intronic
1003224047 6:4188963-4188985 GCCAGGGCGCAGTGGGAAGGGGG + Intergenic
1003832144 6:10023180-10023202 TCAAGGGCGTGGTGGGAAGGAGG - Intronic
1004180819 6:13379117-13379139 CCCAGGGAGTGGTGGGAAGATGG + Intronic
1005301592 6:24476376-24476398 TGAGGGGCATGGAGGGAAGGAGG - Intronic
1005980156 6:30830458-30830480 TCAAGGGAGTGGGGGGTGGGGGG - Intergenic
1007239732 6:40416402-40416424 CCAAGGGGGTGGCGGGAATGAGG + Intronic
1007247368 6:40472192-40472214 TGAAGGGGCTGGAGGGAAGGTGG - Intronic
1007294960 6:40814593-40814615 GCAGGGGCATGGTGGAAAGGTGG + Intergenic
1007299777 6:40858175-40858197 TCAGGGGAAAGGTGGGAAGGGGG - Intergenic
1007636290 6:43301716-43301738 GCATGGGTGTGGTGGGAGGGAGG + Intronic
1008051235 6:46902244-46902266 TCTGGGGCCTGGTGGGGAGGAGG + Intronic
1008662665 6:53684359-53684381 TCAAGGTGGTGGAGGAAAGGAGG - Intergenic
1010018385 6:71130958-71130980 AGAAGGGAGTGGTGGGCAGGAGG - Intergenic
1011252516 6:85387749-85387771 TCAAGTGGGGGATGGGAAGGAGG + Intergenic
1013518862 6:110914503-110914525 TAAAGGGTGTGGTAGGCAGGTGG + Intergenic
1014171968 6:118288714-118288736 TTCAGGGCATGATGGGAAGGGGG - Intronic
1014220690 6:118795902-118795924 TCAAGGGGAAGCTGGGAAGGTGG + Intergenic
1015159791 6:130140013-130140035 TCTGGGGGGTGGGGGGAAGGGGG + Exonic
1015579046 6:134703521-134703543 TAAGGTGAGTGGTGGGAAGGAGG + Intergenic
1016699309 6:147035720-147035742 TCCAGGCCGTGATAGGAAGGGGG - Intergenic
1016904471 6:149135417-149135439 TCAAGTTCTTGGTGGGAAGCAGG - Intergenic
1018093958 6:160368386-160368408 TCAAGGGTGTGGTAGGCAGGTGG - Intronic
1018244487 6:161809249-161809271 TCAAAGGCAGGGGGGGAAGGGGG + Intronic
1018641192 6:165906247-165906269 CCAAGGGCGCAGTGGAAAGGAGG + Intronic
1018927887 6:168219498-168219520 GAAAGGGCGTGGGGTGAAGGGGG - Intergenic
1020093867 7:5356823-5356845 TGAGGGGCGGGGGGGGAAGGAGG + Intronic
1021149614 7:17133583-17133605 ACCAGGGCAAGGTGGGAAGGAGG + Intergenic
1023562712 7:41492474-41492496 CACAGGGAGTGGTGGGAAGGAGG + Intergenic
1023990179 7:45124095-45124117 CCAGGGGGGTGGTGGGGAGGAGG + Intergenic
1025807572 7:64849708-64849730 TCAGGGGTGTGGGGGAAAGGGGG + Intergenic
1026869572 7:73842203-73842225 TGAAGGGGGAGGAGGGAAGGGGG - Intronic
1026896955 7:74014828-74014850 ACAGGGGTGTAGTGGGAAGGGGG + Intergenic
1027230192 7:76267879-76267901 GCCAGGGCTTGGTGGGAAGAGGG - Intronic
1030369904 7:108687078-108687100 GCAAGTGTGTGGTGGGTAGGTGG + Intergenic
1030971642 7:116064542-116064564 TCAAGGGGGTGGAGGGCAAGGGG + Intronic
1032384668 7:131513398-131513420 AGAAGGGAGTGGTGGGAAGGGGG + Intronic
1032523085 7:132561120-132561142 TCAAGGCAGAGGTGGGAAGTGGG - Intronic
1035550165 8:517050-517072 TTCAGGCCGTGATGGGAAGGAGG + Intronic
1037018621 8:13940454-13940476 TTAAAGGCATGGAGGGAAGGGGG + Intergenic
1037818442 8:22124159-22124181 CCTAGGGCTTGGAGGGAAGGAGG - Intronic
1038205134 8:25458430-25458452 CTAGGGGCGGGGTGGGAAGGAGG - Exonic
1038610817 8:29058822-29058844 GCAAGGGCTGGGTGGGAATGAGG - Intronic
1039419164 8:37421244-37421266 TGAAGGGTGGGGAGGGAAGGAGG - Intergenic
1042682482 8:71401132-71401154 TCAGGAGGGTGGTGGGAGGGAGG + Intergenic
1043413106 8:80020335-80020357 TGCAGGCCGTGATGGGAAGGGGG - Intronic
1044399368 8:91752782-91752804 CCAGGGTCGTGGAGGGAAGGAGG - Intergenic
1044753368 8:95437357-95437379 TCAAGAGCTGGGTGGGAGGGAGG - Intergenic
1044891245 8:96838301-96838323 TCAAGGGGGTGGTCAGAATGTGG + Intronic
1045474075 8:102538317-102538339 TCCAGGGTGTGGTGAGGAGGCGG + Intronic
1046053773 8:109055407-109055429 TCAAGGGTGTGGCAGGAAGTGGG - Intergenic
1046172617 8:110530587-110530609 TAAAGGGAGTAGTGGGAAAGTGG - Intergenic
1046790751 8:118319214-118319236 TAATGGGGGTGGTGGGATGGTGG + Intronic
1047285945 8:123487278-123487300 ATAAGGGCGTGGTGGGGTGGTGG + Intergenic
1047824086 8:128554159-128554181 TCAGGAGCGGGGTGGGGAGGAGG - Intergenic
1048304032 8:133271131-133271153 CCCAGGGCCTGCTGGGAAGGAGG - Intronic
1050717771 9:8549057-8549079 TCAAGGGAGTGCAGTGAAGGGGG + Intronic
1050985639 9:12078661-12078683 GGAAGGGGGTGGGGGGAAGGAGG - Intergenic
1051437909 9:17052758-17052780 TCAGGGGCTTACTGGGAAGGAGG + Intergenic
1051660746 9:19424005-19424027 TTAATGGGGTGGTGGGATGGGGG + Intronic
1053221396 9:36316083-36316105 CCAAAGGAGGGGTGGGAAGGAGG + Intergenic
1057082707 9:92185013-92185035 TGAAGGGTGTGGTGGGAGGTGGG + Intergenic
1057082755 9:92185153-92185175 TGAAGGGTGTGGTGGGAGGTGGG + Intergenic
1059668458 9:116471598-116471620 TAAAGGGGGTGGAGGGAGGGGGG + Intronic
1059975594 9:119713518-119713540 TCAAGGGGGAGGGTGGAAGGAGG - Intergenic
1060356089 9:122908620-122908642 AAAATGGCGTGGGGGGAAGGGGG - Exonic
1060563954 9:124572377-124572399 TCAAGAACATGGAGGGAAGGAGG + Intronic
1060812408 9:126617224-126617246 TGCAGGGCGTGGTGGGGAGGGGG - Intronic
1061037917 9:128123709-128123731 GCAAGTGTATGGTGGGAAGGAGG - Exonic
1061356220 9:130107171-130107193 TCATGGGAGTGTTGGGTAGGGGG + Intronic
1061392769 9:130327073-130327095 GCAAGGTGGTGGTGGGGAGGTGG + Intronic
1062076550 9:134593007-134593029 TGAAGGGCAAGGTGGGCAGGTGG + Intergenic
1062347070 9:136119680-136119702 TGACGGGCCTGGTGGGCAGGAGG - Intergenic
1203523941 Un_GL000213v1:68705-68727 TCCAGTGCGCGGTGGGACGGCGG - Intergenic
1185587242 X:1249143-1249165 GCAAGGGCTTGGTGGGGGGGGGG - Intergenic
1185837484 X:3358676-3358698 CCATGGACTTGGTGGGAAGGTGG - Intergenic
1186350184 X:8732186-8732208 TCGAGGGCGAGCTGGGAGGGAGG - Exonic
1187875494 X:23800345-23800367 ACCAGGGCGTGGTGGGGGGGGGG + Intergenic
1190215007 X:48474081-48474103 TCAAGGGCATTGTGGGACTGTGG - Intergenic
1191689553 X:63925996-63926018 CCAAGGGAGGGGTGGGCAGGGGG - Intergenic
1192198609 X:69049039-69049061 TCATGGGCTTGCTGGGAAGGTGG - Intergenic
1192552765 X:72067263-72067285 GCATGGGGGTGGTGGGGAGGAGG - Intergenic
1193278274 X:79617428-79617450 GCATGGGGGTGGTGGGGAGGAGG - Intergenic
1195169660 X:102253923-102253945 TCAGGGTCGGGGTGGGGAGGAGG - Intergenic
1195189197 X:102433176-102433198 TCAGGGTCGGGGTGGGGAGGAGG + Intronic
1195322202 X:103729084-103729106 ACAAGGGCGAGGTGGGATGGGGG - Intergenic
1195934936 X:110115986-110116008 TCAAGGCTGAGGTGGGAAGATGG + Intronic
1197472711 X:126882797-126882819 CCTAGGGAGTTGTGGGAAGGGGG + Intergenic
1198820713 X:140645283-140645305 GCAAGGGAGTGGTGGGGAGTAGG + Intergenic
1199157150 X:144563701-144563723 TCAAGAGAGTTGTGGGGAGGTGG - Intergenic
1199698666 X:150361488-150361510 GCGTGGGCGTGGAGGGAAGGAGG + Intronic
1202085585 Y:21133351-21133373 TGAAGTGGGTGGTGGGATGGTGG - Intergenic