ID: 1003832830

View in Genome Browser
Species Human (GRCh38)
Location 6:10033369-10033391
Sequence GGAGCTGTTGCAAGAGTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 198}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003832820_1003832830 16 Left 1003832820 6:10033330-10033352 CCAAGCTATGCAAAAGCGGCAGA 0: 1
1: 0
2: 0
3: 4
4: 79
Right 1003832830 6:10033369-10033391 GGAGCTGTTGCAAGAGTTCCTGG 0: 1
1: 0
2: 2
3: 13
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003832830 Original CRISPR GGAGCTGTTGCAAGAGTTCC TGG Intronic
900228073 1:1542110-1542132 CGAGCTGCTGCAGGAGTTCGAGG - Exonic
901838130 1:11937291-11937313 GGAGCTCTAACAAGAATTCCAGG + Intronic
902510764 1:16965850-16965872 GCAGCTCTTGCAGGAATTCCCGG - Exonic
902833587 1:19033354-19033376 GAAGCTGTTGAAATAGTTCAGGG - Intergenic
903583879 1:24393427-24393449 GAAGCAGCTGCAAGACTTCCTGG + Intronic
903767911 1:25746720-25746742 GGAGCTGAAGGAGGAGTTCCAGG + Exonic
904285793 1:29452582-29452604 GGAGCTCCTGCAAGGGTTGCAGG + Intergenic
904862779 1:33551412-33551434 GGAGCTGTTGCAGTAGTTCAAGG + Intronic
904881184 1:33698399-33698421 GGGGCTTTTGCCTGAGTTCCAGG - Intronic
905412292 1:37778987-37779009 GGAGCAGATGCAAGAGTTTCAGG + Intergenic
907213369 1:52842322-52842344 GGTGCTGTTGCCAGATTTTCAGG + Intergenic
907756339 1:57314365-57314387 GGAGCTGTGGCCAGAGTTTTGGG + Intronic
910158591 1:84248959-84248981 AAAGCTCTTGCAAGAGTGCCTGG + Intergenic
916174614 1:162027313-162027335 GGGGCTGTTTCAAAAGTGCCAGG + Intergenic
916601523 1:166297903-166297925 GGAGCTGATGCTAGAGGACCCGG + Intergenic
918384511 1:183992097-183992119 TGAGATGTTGCTAGAGTTCTAGG - Intronic
919911501 1:202113643-202113665 GGAGCTGGGGCAGAAGTTCCAGG - Intergenic
922020802 1:221702483-221702505 GGGGCAGTTGCTAGAGTTCGAGG - Exonic
923495721 1:234522616-234522638 GAGGCTGATGCAAGAGCTCCAGG + Intergenic
923547261 1:234931938-234931960 AGGGCTGTTGTAGGAGTTCCTGG - Intergenic
924099833 1:240591770-240591792 GGAGCTGTTTCAAAAGCTCCTGG - Intronic
924783772 1:247175554-247175576 GGAGTTGTAGGAAGAGGTCCTGG - Intergenic
1067839071 10:49661810-49661832 GGAGCTGTAGAATGAGTACCCGG + Intronic
1071940943 10:90591045-90591067 AGATCTGGTGCAAGAGTGCCTGG + Intergenic
1072370898 10:94765646-94765668 GGAGCTGCTGCAGGGGATCCAGG + Intronic
1076627436 10:131830737-131830759 GCAGCGGCTGCAAGAGTCCCTGG + Intergenic
1076729545 10:132431512-132431534 GGAGCTCTTGTCTGAGTTCCAGG + Intergenic
1077392002 11:2304532-2304554 GGAGCTGTTTCCAAAGTCCCTGG + Intronic
1077574952 11:3375907-3375929 GGTGCTGGTGAGAGAGTTCCTGG + Intronic
1078642952 11:13113440-13113462 GGAGCTGGGGCAGAAGTTCCAGG - Intergenic
1078668922 11:13348074-13348096 GGAGCTGCTGCAGGAGAGCCAGG + Intronic
1080046595 11:27815099-27815121 GGAGCTGTTGCAAGTATTTGAGG + Intergenic
1080720619 11:34844783-34844805 GGACCCCTTGAAAGAGTTCCAGG - Intergenic
1083811288 11:65108269-65108291 GGAGCTGTGCGAGGAGTTCCTGG + Exonic
1084599196 11:70134857-70134879 GGGGCTGTGGCAGGAGCTCCAGG + Intronic
1085217196 11:74843367-74843389 GAGGCTGTTGAAGGAGTTCCAGG - Exonic
1087964888 11:104399972-104399994 GGAACTGTCGCAAGAATTGCAGG - Intergenic
1092129000 12:6095478-6095500 GGAGATGTTGCATGAGCTGCTGG + Exonic
1095183889 12:39178713-39178735 GGAGCTGGGGCAAGCGTTCTGGG - Intergenic
1095961696 12:47838876-47838898 GGAGACGCTGGAAGAGTTCCAGG - Intergenic
1096243747 12:49973248-49973270 GGCGCTGTTTGCAGAGTTCCTGG + Exonic
1097080091 12:56423624-56423646 GGAGGAGTTGCAAGTGGTCCAGG - Exonic
1101921841 12:108939310-108939332 GGGGCTGTTTTCAGAGTTCCAGG + Intronic
1101985180 12:109440438-109440460 GGGGCTGTTGTAAGAGTCCCGGG + Intronic
1102430353 12:112878244-112878266 GGAGCAGTAGCCAGTGTTCCAGG - Intronic
1104021136 12:124993434-124993456 GAAGCTGTTGCAAGTTTTACAGG + Intergenic
1104382776 12:128322356-128322378 GGAGCTGAGGCAAGACGTCCTGG + Intronic
1106769258 13:32945719-32945741 GGATCTGATGGAAGAGTTCAGGG + Intergenic
1107657405 13:42605608-42605630 GAAGCTGTAGCAAGAGGACCAGG + Intronic
1109425006 13:62156618-62156640 GGTGCTGCTGCAGGGGTTCCAGG - Intergenic
1110952267 13:81510959-81510981 TCAGCTGTTGCAATAGTGCCTGG + Intergenic
1112412295 13:99174935-99174957 GGAGCTGTTGCATCAGCTCTGGG + Intergenic
1112681982 13:101777431-101777453 GAAGCTGATGTGAGAGTTCCAGG + Intronic
1113599090 13:111555436-111555458 GGCACTGTTGGCAGAGTTCCTGG + Intergenic
1113858332 13:113462514-113462536 GGAGCTGTAGCAAGATTTCCAGG + Intronic
1114697549 14:24641099-24641121 GGAGTTGTTGCAACAGTGGCTGG + Intergenic
1118760976 14:68879985-68880007 GGAGCAGATGAATGAGTTCCGGG - Exonic
1121325379 14:93016675-93016697 GGAGCTGGTGCACAGGTTCCAGG - Exonic
1122243512 14:100384442-100384464 GGAGCTGTGGCCAGAAGTCCCGG + Intronic
1122368928 14:101216887-101216909 GGGGGTGTTGCAAGAGTTCATGG - Intergenic
1123021276 14:105398895-105398917 GGGGCTGTGGCAAGAGCTCTGGG + Intronic
1123051065 14:105542837-105542859 GGAGCTGTTGCAAGAGATACAGG + Intergenic
1202859387 14_GL000225v1_random:72176-72198 GGGGCAGATGCAAGACTTCCTGG - Intergenic
1124270277 15:28274403-28274425 TGAGCTGTTGCAGGAGTCCCTGG - Exonic
1124507740 15:30293190-30293212 GGTGCTGGTGCAAGTGGTCCAGG + Intergenic
1124735816 15:32245468-32245490 GGTGCTGGTGCAAGTGGTCCAGG - Intergenic
1128643518 15:69358195-69358217 GGACCTGTTGCAAGGGCTCTGGG + Intronic
1129335624 15:74850609-74850631 GGAGCTGTTGCCCGAGAACCAGG + Exonic
1130876242 15:88017294-88017316 GGAGCTGTATGAAGGGTTCCTGG - Intronic
1131116541 15:89799613-89799635 GCTGCTCTTGCAAGAGGTCCAGG - Intronic
1132312365 15:100866502-100866524 GGAGCTTTGGCAGGAGTGCCTGG + Intergenic
1132870478 16:2113595-2113617 GGAGCTGGGGCAAGAGCGCCGGG - Intronic
1135947695 16:26879338-26879360 GTAGCTTCTGCAAAAGTTCCAGG + Intergenic
1136236142 16:28914671-28914693 GGAGCTGATTCAGGAGATCCAGG - Exonic
1137606381 16:49789453-49789475 GGGGCTGGTGGAAGAGTTGCAGG - Intronic
1138851674 16:60636719-60636741 GGAGAGGTTTCAAGAGTTCTTGG - Intergenic
1139945125 16:70635590-70635612 GGAGCTGTTTCCAGTGTTCAAGG + Intronic
1141710451 16:85695846-85695868 GGAGCTGTTGCAAGGCTTAAAGG + Intronic
1141883003 16:86872233-86872255 GGAGCCCTTGAAAGTGTTCCTGG - Intergenic
1143518180 17:7430306-7430328 GTGGCTGGGGCAAGAGTTCCGGG - Intergenic
1145689145 17:26716608-26716630 GGAGCGATTTCAGGAGTTCCTGG + Intergenic
1146124050 17:30218186-30218208 GGTGCAGTTGCCAGTGTTCCAGG + Exonic
1147746395 17:42697400-42697422 GGAGCTGTGGCATATGTTCCTGG + Intronic
1147768423 17:42851853-42851875 CGTGCTGTTCCAAGAGTACCTGG + Exonic
1148086731 17:44998096-44998118 GAAGCTGGTGCAAGAATTGCTGG + Intergenic
1148114853 17:45169581-45169603 GGAGCTGGTGCGAGACTACCTGG + Exonic
1148818749 17:50348013-50348035 GAAGCACTTGCAGGAGTTCCTGG + Intronic
1149106815 17:52978448-52978470 GTGGCTGAAGCAAGAGTTCCAGG - Intergenic
1151902793 17:77028085-77028107 GGAGTTGCTGCAAGGGTTCAAGG + Intergenic
1155561595 18:27083711-27083733 GCAGATGTTCCAAGAGTTCTAGG - Intronic
1156485315 18:37461969-37461991 GGTACTGTTGAAAGAGCTCCTGG + Intronic
1157794522 18:50561017-50561039 GGGGCTGTGGCGGGAGTTCCAGG + Intronic
1157886463 18:51371438-51371460 GGAGCTGTTGCACAAATTCAGGG + Intergenic
1158100022 18:53819909-53819931 GGAGTTGTTGCCAGAGGACCAGG + Intergenic
1161494551 19:4580357-4580379 GGAGCGTTTGCAAGAGTCCTGGG - Intergenic
1162236751 19:9315627-9315649 GGCGCTGCTGCAGGGGTTCCAGG + Intergenic
1163272445 19:16262378-16262400 GGAGCTGTGGCAAGGGTGCCTGG - Intergenic
1165830234 19:38727058-38727080 GGAGCAGATGCAGGAGTTCCGGG + Exonic
1166608128 19:44163845-44163867 GGAGCAGATGAAAGAGTTCTAGG - Intergenic
1168180408 19:54658840-54658862 GGAGCAGTTGCAATTGATCCTGG + Intronic
925083718 2:1091299-1091321 GGAGCTGTCCCAAGTGGTCCAGG - Intronic
927352831 2:22137978-22138000 GGAGTTGTTACAAGAGGGCCAGG + Intergenic
928374487 2:30763816-30763838 GGAGCTGTAGCAGTAGGTCCAGG + Intronic
931701683 2:64914221-64914243 GGTGGTGTGGCAAGACTTCCGGG - Intergenic
932754255 2:74395053-74395075 GGTGCTGTTGTAAGAGATCCAGG + Intergenic
934740034 2:96713622-96713644 GGAGCTGTTTCCTGAGATCCTGG - Intronic
937062650 2:118991951-118991973 GGCGCTGTTTTAAGAGTTCTGGG + Intronic
937404109 2:121611361-121611383 GGAGGTGTTGGAGGAGTTACAGG + Intronic
937404179 2:121611724-121611746 GGAGGTGTTGGAGGAGTTACAGG + Intronic
941191768 2:162393101-162393123 GGAGTTGTTGCCAGAGTTGATGG + Intronic
941516821 2:166490805-166490827 GGAGCTTTTGGGAGAGTTGCAGG - Intronic
947059298 2:226144636-226144658 GGAGCTGTTTCCAGTGTGCCAGG - Intergenic
947059355 2:226145262-226145284 GGAGCTGTTGGAAGATAACCAGG + Intergenic
947115846 2:226769388-226769410 GAAGCTGCTGCAAGACTGCCCGG + Intronic
947571094 2:231235219-231235241 GGAGCTGCTGCAAGATTTCTAGG - Exonic
948127883 2:235578093-235578115 GGAGCAGAGACAAGAGTTCCAGG + Intronic
1169171096 20:3466174-3466196 TGAGCTGTTGGCAGAGCTCCTGG - Intergenic
1169224392 20:3847066-3847088 GGCCCTGTCGCAAGAGTTTCGGG + Intronic
1171278882 20:23880175-23880197 GGAGCTGTTTCAGAAGCTCCGGG + Intergenic
1173310386 20:41891834-41891856 GTGGGTGTTGCAATAGTTCCAGG - Intergenic
1173904955 20:46619882-46619904 GGGCTTGTTGCAAGACTTCCTGG + Intronic
1174853927 20:54024674-54024696 GGAGATGATGGAAGAGTACCAGG + Intronic
1177427653 21:20945446-20945468 AGAGCTGTTGAGAGAATTCCAGG + Intergenic
1183381536 22:37492713-37492735 GGTGCTGTTGCCTGAGTGCCTGG - Exonic
1184284841 22:43464711-43464733 TGAGCTGTGGCCAGAGTCCCAGG - Intronic
950087526 3:10270829-10270851 GGAGCTGTTGAAAGAGGATCTGG + Exonic
950901795 3:16504778-16504800 GGAGATGTTGAAACAGTTCTTGG - Intronic
951892707 3:27582043-27582065 AGAGCTGGAGCCAGAGTTCCTGG - Intergenic
952032157 3:29156251-29156273 GGAGCTTTTTCAAGAGCTGCAGG - Intergenic
953599406 3:44348342-44348364 GGAGCTGTTCCCAGAGCCCCTGG - Intronic
953842096 3:46397174-46397196 GGAGCTGTCCCAAGAGCACCCGG - Intergenic
953880373 3:46688240-46688262 GCAGCTGTTGCAAGAGCCGCAGG + Exonic
954160389 3:48717317-48717339 GGCGCTGTTGCTAGGGTGCCAGG + Intronic
960765807 3:121128546-121128568 GGAGTTGATGCAAGAGAGCCAGG + Intronic
963081644 3:141400714-141400736 GAAGCATTTGCAAGAGTACCTGG - Intronic
963290788 3:143485114-143485136 GCAGCTGTGCCAAGTGTTCCTGG + Intronic
963744707 3:149114718-149114740 GGAGGTTTTCCAAGACTTCCTGG + Intergenic
964184114 3:153922202-153922224 GAAGATTTTGCAACAGTTCCAGG + Intergenic
964670631 3:159221324-159221346 GTAGCTGCTACAAAAGTTCCAGG + Intronic
967864187 3:194176748-194176770 GGAGCTGTTGTCAGAGGTGCGGG + Intergenic
968855839 4:3121287-3121309 AGAGCTGCTGCAACAGCTCCAGG - Exonic
969377941 4:6775527-6775549 GGTGGGGCTGCAAGAGTTCCTGG + Intergenic
973811446 4:54574282-54574304 TGATCTGGTCCAAGAGTTCCTGG + Intergenic
977868065 4:102054373-102054395 AGAGTTGTTGCAAGAGTTAAAGG - Intronic
978795941 4:112706983-112707005 GGTGCTGGTGCTATAGTTCCTGG - Intergenic
979099673 4:116599168-116599190 GGAGCAGATGCAGCAGTTCCGGG + Intergenic
980379344 4:131991277-131991299 GGAGTTGGGGGAAGAGTTCCTGG + Intergenic
982176952 4:152714943-152714965 GGAGCTGTTGCAAGAGATGGGGG + Intronic
984819022 4:183863392-183863414 TGAGCTCTTGAAAGAGTTCAAGG + Intronic
985126659 4:186701553-186701575 GGAGCTGGGGCTAGAATTCCTGG - Intronic
987762359 5:22181898-22181920 AGAGATGTGGCAAGACTTCCGGG - Intronic
988105307 5:26739740-26739762 GTGGCTGTTGCTAGAGTGCCAGG + Intergenic
988288637 5:29255658-29255680 GGAACTCTTGCAAGGTTTCCAGG - Intergenic
988288638 5:29255661-29255683 GGAAACCTTGCAAGAGTTCCTGG + Intergenic
991897148 5:71415354-71415376 AGAGATGTGGCAAGACTTCCGGG - Intergenic
992832093 5:80603649-80603671 GCAGTTGTTGCAAGGATTCCTGG + Intergenic
996330496 5:122323131-122323153 GGCGCTGTTGCCCGAGTTCATGG - Intronic
996471638 5:123867784-123867806 GGAGCTATTGCAACAATTCAGGG + Intergenic
997229423 5:132231851-132231873 GGAGCTGTTGCAGTGGTTCCAGG - Intronic
997383718 5:133456150-133456172 GGAGCTCCTCCAAGAGTCCCTGG - Intronic
999299985 5:150485435-150485457 GGAGCTGTCCCAGGAGGTCCTGG + Intergenic
1000549567 5:162643577-162643599 GGTGCTGCTGCTAGAGTTACAGG + Intergenic
1002720712 5:181260000-181260022 GGAGGTGGTGCAGGAGTACCAGG - Exonic
1003832830 6:10033369-10033391 GGAGCTGTTGCAAGAGTTCCTGG + Intronic
1005755219 6:28920078-28920100 GGAGATGTTGCAAGAGAACTGGG + Exonic
1007333822 6:41136764-41136786 GGAGCTGTTAACAAAGTTCCTGG - Intergenic
1009043429 6:58209713-58209735 GGAGCTGTTGTAAGGGTTAAAGG - Intergenic
1009823621 6:68838106-68838128 GTAGCAGTTGGCAGAGTTCCTGG - Intronic
1010018353 6:71130538-71130560 GGAGGTGTTGCAGGTCTTCCTGG + Intergenic
1010316097 6:74452248-74452270 GGAGCTGGAGCAAGAGCCCCTGG - Intergenic
1012399009 6:98829167-98829189 GAAGCTCTTGCTAGAGCTCCTGG - Intergenic
1013270892 6:108544718-108544740 AGAGCTGTTGTAACAGCTCCAGG + Intergenic
1015144511 6:129970715-129970737 GGAGCTATTGCAATAGTCCGTGG + Intergenic
1016666161 6:146643099-146643121 GGAGCTGTTGCTACACTTCTGGG - Intronic
1017887382 6:158610316-158610338 GGAGCTGTTGAAAGAGAATCTGG - Intronic
1019333612 7:472273-472295 GGAGCTGTTGCAAGTGAGCTGGG - Intergenic
1019480563 7:1264810-1264832 GGGGCTGCTGGGAGAGTTCCAGG - Intergenic
1021747729 7:23759862-23759884 GGAGTTGTTACAAGAGATACTGG + Intronic
1027606343 7:80304403-80304425 GGAGATGCTGCAAGATTTCTAGG - Intergenic
1027653018 7:80894690-80894712 GGATCAGTTGCAAGAGTTTGGGG - Intronic
1028185917 7:87785220-87785242 GGGGCTGTCCCAAGTGTTCCAGG + Intronic
1030074054 7:105721381-105721403 GGAGCTGCTGGAAGGATTCCTGG + Intronic
1032265212 7:130365851-130365873 GGAGCAGGTGCAGGAGCTCCTGG + Intronic
1032633426 7:133679503-133679525 GGGGCAGTAGCAAGAGCTCCTGG - Intronic
1032723441 7:134569564-134569586 TGAGCTGTTGCAGGAATTCAGGG + Intronic
1033260812 7:139842642-139842664 GGTGCTGTTGCACAACTTCCTGG + Intronic
1034439469 7:151079373-151079395 GGAGCAGGAGCAAGCGTTCCTGG + Intronic
1036469332 8:9037394-9037416 GGAGTTGTTGCCAAAGGTCCGGG - Intronic
1041002656 8:53467301-53467323 GGTGCTGTTGCAGGGGGTCCGGG - Intergenic
1046729904 8:117713595-117713617 GGAGCTTTTGCAGCTGTTCCTGG - Intergenic
1046791789 8:118330249-118330271 GGCCTTGATGCAAGAGTTCCTGG + Intronic
1047473664 8:125204303-125204325 GGAGGTGTTCCCAGACTTCCTGG + Intronic
1047779768 8:128101603-128101625 GGGGCTGTTACAAAAATTCCAGG - Intergenic
1050299424 9:4242172-4242194 GGAGCTGTTTCATGGGGTCCAGG - Intronic
1052853907 9:33395107-33395129 GAAGATGGTGCGAGAGTTCCTGG - Exonic
1057354202 9:94321380-94321402 GGAGCTGCTCCCAGAGTTCTGGG + Intronic
1057653562 9:96936255-96936277 GGAGCTGCTCCCAGAGTTCTGGG - Intronic
1058688064 9:107495242-107495264 GGAGCTGTTGAAAGACTGGCTGG - Intergenic
1059339130 9:113587524-113587546 GGAGTTGTCCCAAGGGTTCCAGG + Intronic
1061261790 9:129484192-129484214 GGAGCTGTGTCAAGTGTTCATGG - Intergenic
1061844557 9:133379763-133379785 AAAGCTGCTGCAAGAGTCCCTGG + Intronic
1062206687 9:135341553-135341575 GGAGAGGTGGCAAGAGGTCCAGG + Intergenic
1185652664 X:1660256-1660278 GGAGCCGTTGCACGATCTCCGGG + Intergenic
1186015705 X:5190831-5190853 GAAGCTGTTGCAATAGTTTTTGG - Intergenic
1186746792 X:12577752-12577774 GGAGTGGATGCAAGAGTTTCAGG + Intronic
1187306393 X:18098950-18098972 GGAGTTGCTGTCAGAGTTCCCGG - Intergenic
1191053420 X:56218294-56218316 GGAGCTGAGCCAAGAGGTCCGGG + Intergenic
1191085495 X:56563585-56563607 GGAGCGGCTGCCAGAGTTGCTGG + Intergenic
1194973655 X:100371769-100371791 GGAGCTGTTTTCAGGGTTCCAGG - Intronic
1196296449 X:114003070-114003092 GATGCTGTGGCAATAGTTCCAGG + Intergenic
1196687218 X:118521672-118521694 GTGGCTTTTGCAAGAGCTCCAGG - Intronic
1199656769 X:150004063-150004085 GGAGCTGTTGCTGGGATTCCAGG + Intergenic
1201073793 Y:10171784-10171806 GGAGCTGTTGGGAGGGTGCCTGG + Intergenic
1201472710 Y:14351692-14351714 GGAGCTGCTGCAGGGGTTCCAGG + Intergenic