ID: 1003835823

View in Genome Browser
Species Human (GRCh38)
Location 6:10071456-10071478
Sequence CCTTATGTGGAGACTTTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 127}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003835823 Original CRISPR CCTTATGTGGAGACTTTGTA AGG Intronic
901152319 1:7112088-7112110 CCTTATCTGGAGCCTTTGTAGGG + Intronic
906988428 1:50711817-50711839 CCTTATGAGTAGAGTTTGTTTGG + Intronic
908686113 1:66721888-66721910 TGATATGTTGAGACTTTGTAGGG - Intronic
916683142 1:167122119-167122141 GATTAAGTGGTGACTTTGTATGG + Intronic
916808236 1:168280913-168280935 CATAATGTGGAGACTTTTAAGGG + Intergenic
917917292 1:179715490-179715512 GCTTATGTGGAGCCTTTCTCTGG - Intergenic
919863135 1:201756442-201756464 CCTTGTGTTGATATTTTGTAGGG - Intronic
920810048 1:209276217-209276239 CCTTTTGTTGATCCTTTGTACGG + Intergenic
920879709 1:209868262-209868284 CTTTATGTGGGTACATTGTATGG - Intergenic
921400472 1:214717205-214717227 CATTATGTGGGGACTGTTTAAGG - Intergenic
922120519 1:222662974-222662996 ACTTATGTGGACACTGTTTAAGG - Intronic
1065377782 10:25060510-25060532 GCTTATGTGGAGAGTATGTGGGG - Intronic
1065536650 10:26721719-26721741 CCTTATGTGGAGCCTTGGGCGGG + Intronic
1065607384 10:27432160-27432182 CTTTATATGGAGATTATGTATGG + Intergenic
1065813658 10:29464967-29464989 TCTGCTGTGGAGACTTGGTATGG + Intronic
1070376912 10:75841522-75841544 ATATATGTGGAGACTTTGAATGG + Intronic
1073846568 10:107562559-107562581 ACTTATGTGGAGCCCTTCTAGGG - Intergenic
1076755076 10:132565378-132565400 CCTGATGTGCACAGTTTGTAAGG + Intronic
1079793762 11:24772606-24772628 CCTTATATGGATAGTTTATAGGG - Intronic
1088658181 11:112021672-112021694 CCTTAAATGAAGATTTTGTAAGG - Intronic
1088759780 11:112918504-112918526 CTTTCTGTGGAGACTTTCTTTGG - Intergenic
1089473745 11:118741760-118741782 GCTTATATGGAGGCTTTGAAAGG - Intergenic
1090779757 11:129997042-129997064 CCCTGTGTGGAGATTTTATATGG - Intronic
1093086870 12:14875794-14875816 CCTTATGAGGAGTCTTGGAAAGG - Intronic
1093140760 12:15507983-15508005 ACTTCTGTGGAGACATTTTATGG + Intronic
1099132130 12:78846769-78846791 CCTTATTGGGAGGCTTTGTAGGG + Intergenic
1100956159 12:99910987-99911009 TATTATTTGGTGACTTTGTAAGG - Intronic
1105990845 13:25619145-25619167 CCTTTTGTGGAGGCTTTTCAGGG + Intronic
1106188498 13:27428927-27428949 CCTTATTTAGAGACTTTGTGGGG + Intronic
1107188538 13:37551214-37551236 ACTTCTGTGGGGTCTTTGTAAGG - Intergenic
1109379703 13:61543531-61543553 CATTATGTGTAGACTTCTTATGG - Intergenic
1111354877 13:87085690-87085712 CTTTATGTGAAGACATTTTATGG - Intergenic
1112822873 13:103356411-103356433 CCCTCTGTGGGGACATTGTATGG - Intergenic
1114927496 14:27422167-27422189 TCATCTGGGGAGACTTTGTATGG + Intergenic
1116194985 14:41714086-41714108 CATTATGTGTATCCTTTGTATGG + Intronic
1116276288 14:42837415-42837437 CATTAAGTGGAGACTATGAAAGG - Intergenic
1116865488 14:50028445-50028467 CCTCATGTGGAGATTTTGCAGGG - Intergenic
1120479325 14:85029203-85029225 CCTTCTGTGAAGACTTGGTCTGG + Intergenic
1122280193 14:100617666-100617688 TCTTATGTGGAGCATGTGTATGG + Intergenic
1122801975 14:104235603-104235625 CCTTAAGTGGAGACATTGAATGG + Intergenic
1125349668 15:38753729-38753751 CCTTATTGTGAGACTATGTAGGG + Intergenic
1126273911 15:46853687-46853709 CTTTAGCTGGAGACTCTGTATGG - Intergenic
1128627713 15:69227852-69227874 GCTTATGTGGAAACTGGGTAAGG + Intronic
1130659447 15:85818794-85818816 TCTTATGTTTAGAGTTTGTATGG + Intergenic
1130984048 15:88833264-88833286 CATTATGTGGAGATTTGGTAGGG - Intronic
1131024218 15:89126111-89126133 CCTTTTTTGGAGACATAGTAGGG - Intronic
1135061275 16:19273118-19273140 CTTTATGTGGAGATTAAGTATGG - Intergenic
1139525873 16:67516186-67516208 CATTATGTGGAAACTTAGCAAGG + Intergenic
1149021058 17:51964940-51964962 CCTTTTGTTGACCCTTTGTATGG - Intronic
1149154891 17:53616417-53616439 CATTATTTGGAGACTTTTGAAGG + Intergenic
1155609610 18:27650628-27650650 GCTTATGTGGGGAAATTGTAAGG - Intergenic
1162528331 19:11220329-11220351 CCCTCTGTTGAGACTTTTTAGGG - Intronic
1166627352 19:44370886-44370908 CCTTAAATGGAGACTATGGAGGG + Intronic
1167468477 19:49662658-49662680 CCTTTTCTGGAGACTTCATATGG + Intronic
927816818 2:26224698-26224720 CTTTATTTGAAGACTATGTATGG + Intronic
928666587 2:33556195-33556217 CTTTATGTGGACAGTTTATATGG + Intronic
929880610 2:45833951-45833973 ACTAATGTGGAGAGTGTGTAAGG - Intronic
932013246 2:67999255-67999277 CTTTATTTGGAAACTTAGTAGGG - Intergenic
936416560 2:112319673-112319695 CCTTATGTTGAGAATAGGTATGG + Intronic
936559341 2:113523168-113523190 ATTTATGTGTAGACTTTGTTCGG + Intergenic
936882452 2:117270353-117270375 TCTTATATGGAGGCTTTGTGTGG - Intergenic
937939936 2:127277291-127277313 GGTTATGTGAAGACTTTGGAGGG + Intronic
938370442 2:130764743-130764765 CCTGATGTGGGGACTGTGTTGGG + Exonic
938546146 2:132333671-132333693 CCTTAAATGGAGACTATGGAGGG - Intergenic
940289902 2:152068289-152068311 CCTCATGTGAAGACTTTGCAGGG - Intronic
943460523 2:188167495-188167517 CCTTCTCTAGAGACTTTGGAGGG - Intergenic
947853566 2:233307848-233307870 ACGTATGTGGGGAATTTGTAGGG - Exonic
1169611128 20:7381228-7381250 CATTATTTGGAGCCTTTGTCAGG - Intergenic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1171875010 20:30566404-30566426 CCTTAAATGGAGACTATGGAGGG - Intergenic
1178164124 21:29952483-29952505 CCATATGTGTAGACTGAGTATGG - Intergenic
1178854499 21:36239285-36239307 CCCTATGAGGGGACTTTGCAGGG + Intronic
1184665378 22:45986285-45986307 TCTTATCTGGAGGCTTTGGAAGG - Intergenic
1184788658 22:46685409-46685431 CCTTTTGGGGAAACTTTGTGAGG + Exonic
949615022 3:5744203-5744225 CTTTATTTGGAGATTATGTATGG + Intergenic
949737092 3:7185840-7185862 CATGATTTGGAGACTTTGAAGGG - Intronic
950276479 3:11665636-11665658 TGTTCTGTGGAGACTTTGTCAGG - Intronic
951280897 3:20748137-20748159 ACTGATGTGGAGACTGTGGAAGG + Intergenic
952753894 3:36849281-36849303 CCTTCTGTGGGGACTTAGAAGGG - Intronic
957898679 3:86458533-86458555 TCTTATGTGGAGATTTTCTCAGG + Intergenic
957926270 3:86816734-86816756 TCTTCTGTGCAGACTTTCTAAGG - Intergenic
958044560 3:88267723-88267745 ACGTATGTGGATACGTTGTATGG + Intergenic
958180222 3:90050340-90050362 CCTTATGTGTTGACTTGGTTAGG - Intergenic
960974858 3:123163763-123163785 CGTTATTTGGAGTATTTGTAGGG + Intronic
967164104 3:186765313-186765335 TATTATTTGTAGACTTTGTATGG - Intergenic
967767969 3:193303103-193303125 CCAGATGTGGAGACCTTGCAGGG - Intronic
970064433 4:12075704-12075726 ACTTATGTAGAGACTCTGAAAGG + Intergenic
970809450 4:20074643-20074665 CCTTCTTTGGAGACTTCGAAAGG - Intergenic
973028576 4:45305953-45305975 CTTTATTTGGAGACTATATATGG + Intergenic
976797809 4:88954475-88954497 CCTTATTTGTAAACTTTTTAGGG - Intronic
977817577 4:101432764-101432786 TCTTTTGTGGAGAGTTTTTATGG + Intronic
979685207 4:123504285-123504307 ACTTGTGTGAAGACATTGTATGG + Intergenic
981047787 4:140281451-140281473 CCATATGTGGAGCCTTGGGATGG - Intronic
981299019 4:143166264-143166286 CCTTATGTGTATCCTTTCTAGGG + Intergenic
984578099 4:181474800-181474822 TCTTATGTGGAGACCTAATATGG + Intergenic
985387729 4:189464763-189464785 CCTTTTGTGGAGCTTTTGTATGG - Intergenic
986020447 5:3796621-3796643 TTTTATGTGATGACTTTGTAAGG + Intergenic
986049033 5:4069949-4069971 CCTTATCTGGAGACTTAATGGGG + Intergenic
988670792 5:33379006-33379028 CCTTATGTGGAGTCTCAGCACGG - Intergenic
995234423 5:109810582-109810604 CATTTTGTGGAGACTTTGGGAGG - Intronic
996366607 5:122708047-122708069 ACAGATGTGGAGCCTTTGTATGG + Intergenic
998889618 5:146732029-146732051 CCTTCTGTGGAGATTTTTGATGG + Intronic
999122272 5:149218621-149218643 CCTTGTGGAGAGACTTTGTTTGG + Intronic
999425188 5:151481864-151481886 CCTTATGTCCAGACCTTGTGTGG + Intronic
1000074899 5:157775777-157775799 GCTTTTGTGAAGACTTTGAAAGG - Intergenic
1002422966 5:179159226-179159248 CCTTCTGTGGAGGCCTTGCACGG - Intronic
1003835823 6:10071456-10071478 CCTTATGTGGAGACTTTGTAAGG + Intronic
1006737288 6:36283480-36283502 CCTTACGTGGTGATTTCGTAAGG - Intronic
1008819223 6:55609994-55610016 CCTTTTGTGAAGACTTTTTTTGG - Intergenic
1010624171 6:78115554-78115576 CTTCTTGTGGAGAGTTTGTATGG - Intergenic
1015617140 6:135089335-135089357 CATTTTGTGGTGACTTTTTAGGG - Intronic
1016076494 6:139802808-139802830 CATTTTGTGGAGGCTGTGTAAGG + Intergenic
1024620317 7:51151452-51151474 TCTTATGGGGAGACTCTGGAAGG - Intronic
1029266619 7:99347027-99347049 CCTTTTTTAGAGACTTTGTGGGG + Intronic
1030171109 7:106603641-106603663 CCTTATTTATTGACTTTGTAGGG - Intergenic
1032287075 7:130547034-130547056 ACTTATTTGGAGACTTGGGAAGG - Intronic
1039373186 8:37007697-37007719 CCCTATGTGGGGAATTTGGAAGG - Intergenic
1039830766 8:41212069-41212091 CCCAATGTGGAGTCTTTGCAAGG + Intergenic
1042719229 8:71809051-71809073 CCTTATATGGAGAATTCGAAGGG - Intergenic
1043243390 8:77965744-77965766 TCTTATGTGTAGACCTTGGATGG - Intergenic
1044324817 8:90847514-90847536 CCTCAGGTGGGGACTTTGTGTGG + Intronic
1047132392 8:122036085-122036107 GCATATGTGGAGATTTTTTATGG - Intergenic
1048296417 8:133217880-133217902 CTGCATGTGGAGACTTTGGAGGG - Intronic
1049893514 9:93029-93051 ATTTATGTGTAGACTTTGTTCGG - Intergenic
1051503522 9:17803668-17803690 CCTTAGGTGAAGACTTTGCAAGG + Intergenic
1052018603 9:23498949-23498971 CCTTATGTGGAGGTTTTGGGAGG + Intergenic
1052022770 9:23543753-23543775 CCTTATTTGGGGACATTGTAAGG + Intergenic
1053734733 9:41093097-41093119 ATTTATGTGTAGACTTTGTTCGG - Intergenic
1055245670 9:74239717-74239739 TCTTATGTTGAGACTTTTGAAGG - Intergenic
1055998493 9:82189137-82189159 CATTATATGGTGACCTTGTAGGG - Intergenic
1058212627 9:102189080-102189102 CTTTATGTGGAGAAGTTCTACGG + Intergenic
1061290017 9:129645398-129645420 CCTTCTCTGGAGTCTTTGGAGGG - Intergenic
1062429290 9:136519886-136519908 CCCCCTGTGGAGACATTGTAGGG - Intronic
1186031355 X:5372816-5372838 CCTAATGTGGATATTTTGTTAGG - Intergenic
1191678727 X:63818611-63818633 CCTTCAGTGGAGATTCTGTAAGG + Intergenic
1191892604 X:65960107-65960129 GCTTATGTGGAAACTTTTCAGGG + Intergenic
1198244248 X:134814286-134814308 CCTTATATGGAGACTTGTTTAGG + Intronic
1199655584 X:149991898-149991920 CCATATGTGAAGACTTTACATGG - Intergenic