ID: 1003843920

View in Genome Browser
Species Human (GRCh38)
Location 6:10152707-10152729
Sequence GGATGAACAAACTCTCTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003843918_1003843920 -7 Left 1003843918 6:10152691-10152713 CCATAGCTTAAAGCAGGGATGAA 0: 1
1: 0
2: 1
3: 4
4: 153
Right 1003843920 6:10152707-10152729 GGATGAACAAACTCTCTAAAGGG 0: 1
1: 0
2: 1
3: 18
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003843920 Original CRISPR GGATGAACAAACTCTCTAAA GGG Intronic
900172484 1:1275730-1275752 GGCAAAACAAACTTTCTAAAGGG - Intergenic
900330672 1:2133035-2133057 GGGTGAACAAACTCTCCCACAGG - Intronic
909917147 1:81334328-81334350 AGATAAACAAACTCTCAAAAGGG + Intronic
912729240 1:112087285-112087307 AGTTGAACATACTATCTAAAGGG - Intergenic
913036846 1:114975907-114975929 GTTTGAACAAACTCAATAAAAGG - Intronic
916943712 1:169702692-169702714 GGATGACAAAAGTCTTTAAATGG - Intronic
917985124 1:180308767-180308789 GGGTGAGCAAACACTCTAACTGG - Intronic
919338203 1:196267227-196267249 GGATGAATAAACATTCAAAAAGG + Intronic
921535092 1:216339184-216339206 GAATGAACAAAATATCAAAATGG + Intronic
922711909 1:227840648-227840670 GGGTGAGCAAACTCTGTAAAGGG - Intronic
1069076507 10:64042954-64042976 GGTTGAACAAACTCTATTAGTGG - Intergenic
1069095607 10:64255966-64255988 AAATGATTAAACTCTCTAAATGG + Intergenic
1074093120 10:110282294-110282316 GGATGAAAAAACTATTTAAAAGG - Intronic
1079285072 11:19121692-19121714 GTATGAACAAACACACTACATGG - Intronic
1080291525 11:30676424-30676446 GGATTAAGAAACTCACTCAAAGG + Intergenic
1086179924 11:83938468-83938490 CCATTAACAAACTCCCTAAATGG - Intronic
1087300179 11:96423904-96423926 GGATGACTAAACTATCTAGATGG + Intronic
1087784311 11:102337934-102337956 GAATAAACAAACTTACTAAAGGG - Intronic
1093146404 12:15571775-15571797 AGATGCACAGAATCTCTAAATGG + Intronic
1095391308 12:41709909-41709931 GCCTGAACAAACTCTCTAAAGGG - Intergenic
1099109967 12:78546576-78546598 GTATAAAGGAACTCTCTAAATGG - Intergenic
1099175878 12:79421379-79421401 AGAAGCACAGACTCTCTAAATGG - Intronic
1101107046 12:101450986-101451008 GGAGGTAAAAAATCTCTAAAAGG - Intergenic
1105316789 13:19272975-19272997 GGATTAAGAAACTCACTCAAAGG + Intergenic
1107539874 13:41378679-41378701 GGATGAACATACTGAATAAAAGG - Intergenic
1108121087 13:47188216-47188238 GAATCTTCAAACTCTCTAAATGG - Intergenic
1108510180 13:51148716-51148738 GGAAGAACAAACCCCCTAACTGG + Intergenic
1110178238 13:72583973-72583995 GGATGGACATACACTATAAAGGG - Intergenic
1110334376 13:74309899-74309921 GGATGATCAAATTCTGAAAATGG + Intergenic
1110478681 13:75948088-75948110 GGATCAACCACTTCTCTAAAAGG + Intergenic
1110631893 13:77718171-77718193 GAGTGAACAAACTGTCTCAAGGG + Intronic
1113246815 13:108405502-108405524 GGATGAAGAAATTTTCTAGAGGG - Intergenic
1119883570 14:78121654-78121676 GGATGAACAGACTGTCTCCAGGG + Intergenic
1124801573 15:32838068-32838090 GGATGAACAACCACAATAAAAGG + Intronic
1125217989 15:37299897-37299919 AGATGAACAAACTCTTATAATGG + Intergenic
1128495585 15:68196669-68196691 GGAAGAACAAAGGCTGTAAATGG + Intronic
1130744068 15:86631653-86631675 GGATGAACACACTCCCTGATGGG + Intronic
1130848543 15:87770409-87770431 GGATAAAGAAACTCACTCAAGGG + Intergenic
1137372116 16:47917109-47917131 GGATGAATAGAATCTCCAAAAGG - Intergenic
1137553682 16:49456843-49456865 GGAAGTACAAACTGTCCAAATGG + Intergenic
1139013316 16:62659765-62659787 GGAAGTACAAACTCTCTACTTGG - Intergenic
1141224775 16:82104706-82104728 AGAAGAACTCACTCTCTAAAAGG + Intergenic
1147117310 17:38311114-38311136 AGATGAACAAAATCTGGAAATGG - Intronic
1148412372 17:47478472-47478494 AGATGAACAAAATCTGGAAATGG + Intergenic
1148763583 17:50022471-50022493 AGATTAACAAACTTTGTAAAAGG + Intergenic
1148987159 17:51632969-51632991 AGATGAACAAATACTCTAAAGGG - Intronic
1149559365 17:57597117-57597139 AGGTGGACAAACTCTGTAAAGGG + Intronic
1153030753 18:711233-711255 GGATGAACTTAATCTCAAAAAGG + Intronic
1155040135 18:22058182-22058204 GGATACTCAAACTCTGTAAAGGG + Intergenic
1155216595 18:23648543-23648565 GGATGGAAAAGCTCTCTAAGTGG + Intronic
1156039137 18:32800034-32800056 GGATGCAAAAACTATCTCAAGGG + Intergenic
1157487265 18:48097037-48097059 GGCTGGACAGACCCTCTAAAAGG - Intronic
1157720389 18:49918873-49918895 GGATGGACAAAATTTCTAAAGGG + Intronic
1161616357 19:5272916-5272938 GGAGGAACAAACACTCTGATTGG - Intronic
1164268413 19:23644344-23644366 GGATGTAAAATCTCTCTACAAGG - Intronic
1164475190 19:28570233-28570255 AAATGAACAAAATCTATAAAAGG - Intergenic
1167887001 19:52508438-52508460 CCATGACCAAATTCTCTAAAAGG + Intronic
925495178 2:4440080-4440102 GAATGTCCAAACTCTTTAAATGG - Intergenic
927638060 2:24830345-24830367 GGAGAAACTAACTCTCAAAAAGG - Intronic
929774402 2:44919485-44919507 GGATTAGCAAACTCTGTAAAAGG + Intergenic
929876988 2:45804911-45804933 AGCTGAACAAAGTCTTTAAAAGG - Intronic
930294119 2:49531764-49531786 GAATTGAAAAACTCTCTAAAGGG + Intergenic
930471471 2:51821083-51821105 GGCTGAACAAAACATCTAAAAGG - Intergenic
930623652 2:53670982-53671004 GGATGAACCAACTTTAGAAATGG + Intronic
934803994 2:97199682-97199704 GGATGAAGAAACTTTCGGAAGGG + Intronic
937028167 2:118716481-118716503 GGATGAAGTAACTCTACAAAGGG + Intergenic
940233189 2:151481144-151481166 GGATTGACAAACTCTTTAAAAGG - Exonic
941055606 2:160784579-160784601 GGATGGACTATGTCTCTAAAAGG + Intergenic
942908916 2:181218037-181218059 GGAAAACCAAACTCTCTAGAAGG - Intergenic
943534562 2:189131784-189131806 GGATGAAGAAATTCTCTTAGAGG - Intronic
943778272 2:191792189-191792211 AGATAAGGAAACTCTCTAAAGGG - Intergenic
945384137 2:209176938-209176960 GGAAGAACACACTGTCAAAAGGG - Intergenic
1170439379 20:16363199-16363221 GGATGAACAGACTCTGCAGATGG + Intronic
1172623787 20:36336052-36336074 GGATTGGCAAACTCTCTAAAGGG - Intronic
1175256021 20:57647711-57647733 GGCTGTACAGACTCCCTAAAGGG - Intergenic
1176518622 21:7807368-7807390 GGAAGAAGAAAATCACTAAATGG - Intergenic
1178652650 21:34437381-34437403 GGAAGAAGAAAATCACTAAATGG - Intergenic
1178768981 21:35484627-35484649 TATTGAAGAAACTCTCTAAAAGG + Intronic
1184941163 22:47766452-47766474 GGTTAAACACACTCTCCAAATGG + Intergenic
952882936 3:37996724-37996746 GGATGAAGATAGTCTCCAAACGG - Intronic
953363216 3:42319168-42319190 GCAAAAACAAACACTCTAAATGG - Intergenic
955659582 3:61282603-61282625 GGATGCAAAAACAATCTAAATGG - Intergenic
955866527 3:63390277-63390299 GCAAGAACACACCCTCTAAATGG + Intronic
957886633 3:86296896-86296918 GGATAAAAAAAGTCTGTAAAGGG - Intergenic
958145285 3:89615403-89615425 GGGTAAATAAACTTTCTAAAGGG - Intergenic
960646596 3:119891887-119891909 GGATGAACAACATCCCCAAAGGG - Intronic
961584822 3:127913690-127913712 GGATGAAAAAATTCTGGAAATGG + Intergenic
963879552 3:150513695-150513717 AGATGAACAGTCTCTCTTAAAGG + Intergenic
964774242 3:160257694-160257716 GGATGAACAAATTCTGGAAATGG - Exonic
967584908 3:191201040-191201062 AAATGAACCAACTCTCCAAATGG + Intronic
972256005 4:37356209-37356231 GAATGAAAAATCTCTCTAAATGG + Intronic
975256749 4:72246051-72246073 GAATGAACAAAACCTTTAAAGGG + Intergenic
976548948 4:86372217-86372239 GGATTAAGAAACTCACTCAAGGG + Intronic
977357048 4:95959657-95959679 GGATGAACAAACTCATGAGAAGG + Intergenic
980581203 4:134754168-134754190 GGATGAAAAATCTGTCAAAATGG + Intergenic
984460806 4:180034451-180034473 GCATGAAGAAACCCTTTAAAAGG + Intergenic
984658720 4:182349900-182349922 GGATGAAATAACTCACCAAAAGG + Intronic
984660088 4:182364061-182364083 GAAAGCACAAACTCTTTAAATGG - Intronic
986554103 5:8993454-8993476 GTATGAACAAATCCTCTACAAGG - Intergenic
987446111 5:18021616-18021638 GGTGGAATAACCTCTCTAAAGGG + Intergenic
988081491 5:26420430-26420452 GGATAAACACATTCACTAAATGG - Intergenic
989096658 5:37788237-37788259 AGATGAACAAGATCTCTGAAAGG - Intergenic
989823483 5:45824736-45824758 AGATGAATAATCTCTTTAAAAGG - Intergenic
998652537 5:144137105-144137127 TGATGAACAAAATATCAAAAAGG + Intergenic
998817726 5:146030972-146030994 GGATCTGCAAACTCTCTAAAGGG - Intronic
998965604 5:147537332-147537354 GAATTAACAAACTCTCGAAAAGG - Intergenic
1001944679 5:175769171-175769193 GGAATAACAAAATTTCTAAATGG + Intergenic
1003058629 6:2844464-2844486 GGATGAACGCACTCCCTCAAGGG + Intergenic
1003150229 6:3542041-3542063 GGATGAACAAACACAGTAAATGG + Intergenic
1003843920 6:10152707-10152729 GGATGAACAAACTCTCTAAAGGG + Intronic
1008791757 6:55243566-55243588 CGATGAGCAAATTCTTTAAAAGG - Intronic
1010446728 6:75957216-75957238 GGATTAAGAAACTCACTCAACGG - Intronic
1011246784 6:85327862-85327884 GGATGAAAAAGCTCTTGAAATGG - Intergenic
1015121258 6:129704015-129704037 GAATGAAGAAACTTTTTAAATGG + Intronic
1015474215 6:133641466-133641488 GGATGACCAAACTGTCCATAGGG - Intergenic
1017356487 6:153515615-153515637 TGATGAACAAATTCAGTAAAGGG - Intergenic
1024868929 7:53939102-53939124 TGAAGAACAAAATCTTTAAATGG + Intergenic
1027451351 7:78335150-78335172 AAATCAGCAAACTCTCTAAAGGG - Intronic
1027525107 7:79258875-79258897 CAATGAACAAACTTTCAAAATGG + Intronic
1028519550 7:91715115-91715137 GAATGAACTAACTCTATTAATGG + Intronic
1029132458 7:98342738-98342760 GGATGAAAAAACTGACTCAAAGG + Intronic
1030251840 7:107454869-107454891 GGAAGGAAATACTCTCTAAAAGG - Intronic
1030863266 7:114664444-114664466 TGGTTAACAGACTCTCTAAAGGG + Intronic
1031176042 7:118351782-118351804 GGATGAACAAAATTTCTAAGAGG + Intergenic
1031851667 7:126872208-126872230 GGATGAGCAAACTCTTCAAAGGG + Intronic
1032747332 7:134799365-134799387 GGTTGAACTAACTCTCAAATAGG + Intronic
1033733250 7:144198268-144198290 GGAAGAGCAAACTCCCTAAATGG - Intergenic
1033749800 7:144352705-144352727 GGAAGAGCAAACTCCCTAAATGG + Intergenic
1035711078 8:1715013-1715035 GGATTAAGAAACTCACTCAATGG + Intergenic
1036051380 8:5202350-5202372 TCATGAACAAAGTATCTAAAAGG - Intergenic
1043337152 8:79190411-79190433 CTATGAACAGCCTCTCTAAATGG + Intergenic
1044548946 8:93490705-93490727 GGATGAACTTTTTCTCTAAAGGG + Intergenic
1045126630 8:99098318-99098340 GGAAGAAAAGACTCTCTAAAAGG - Intronic
1045550663 8:103169351-103169373 GAATAAACAAACTCTATAAGGGG - Intronic
1051608828 9:18942217-18942239 GCCAGAATAAACTCTCTAAATGG + Intronic
1051968604 9:22860719-22860741 GGATCAAAAAACTCTCTATGGGG + Intergenic
1052143260 9:25015629-25015651 GTATGACCAACCTCTCTTAAGGG + Intergenic
1052553903 9:29987970-29987992 GGATAAACAAAGCCTCCAAAAGG - Intergenic
1055807694 9:80115377-80115399 AGATGAACACATTCTTTAAAAGG - Intergenic
1056793961 9:89644182-89644204 GGATGAACACACACTCACAATGG - Intergenic
1061302996 9:129716840-129716862 GGAAGAACTAACTCTTAAAATGG + Intronic
1185791938 X:2933772-2933794 CGATAAACAAACACTATAAATGG + Intergenic
1186684457 X:11910966-11910988 GAATAGACAATCTCTCTAAAGGG - Intergenic
1188198978 X:27276424-27276446 GGATGAACAATCTTACCAAAGGG + Intergenic
1188566899 X:31536904-31536926 GGAAGAACACACTCTTAAAAGGG - Intronic
1190625561 X:52335191-52335213 AGATCAACGGACTCTCTAAAGGG + Intergenic
1192674343 X:73179995-73180017 GTATGAAATAACTCACTAAATGG + Intergenic
1194651496 X:96520166-96520188 GGATGCAAAAAATCTCTACAAGG - Intergenic
1195023990 X:100856998-100857020 GGATCAAAAAACTATCTAATGGG - Intronic
1197136634 X:123068174-123068196 GGATGTGAAAACTCTCTACAAGG + Intergenic
1199166864 X:144686548-144686570 GGCAAAATAAACTCTCTAAATGG + Intergenic
1199915325 X:152333646-152333668 TGAAGAACAAATTCTCAAAATGG + Intronic