ID: 1003844511

View in Genome Browser
Species Human (GRCh38)
Location 6:10159103-10159125
Sequence CAGATGCCCAGCTCTCATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 168}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003844511_1003844518 27 Left 1003844511 6:10159103-10159125 CCTTAATGAGAGCTGGGCATCTG 0: 1
1: 0
2: 1
3: 6
4: 168
Right 1003844518 6:10159153-10159175 GCCGGGTCCCCAGTGTGGACAGG 0: 1
1: 0
2: 0
3: 19
4: 135
1003844511_1003844514 9 Left 1003844511 6:10159103-10159125 CCTTAATGAGAGCTGGGCATCTG 0: 1
1: 0
2: 1
3: 6
4: 168
Right 1003844514 6:10159135-10159157 GCCAGGAAGAAAATGTGTGCCGG 0: 1
1: 0
2: 1
3: 28
4: 357
1003844511_1003844517 22 Left 1003844511 6:10159103-10159125 CCTTAATGAGAGCTGGGCATCTG 0: 1
1: 0
2: 1
3: 6
4: 168
Right 1003844517 6:10159148-10159170 TGTGTGCCGGGTCCCCAGTGTGG No data
1003844511_1003844516 10 Left 1003844511 6:10159103-10159125 CCTTAATGAGAGCTGGGCATCTG 0: 1
1: 0
2: 1
3: 6
4: 168
Right 1003844516 6:10159136-10159158 CCAGGAAGAAAATGTGTGCCGGG No data
1003844511_1003844513 -8 Left 1003844511 6:10159103-10159125 CCTTAATGAGAGCTGGGCATCTG 0: 1
1: 0
2: 1
3: 6
4: 168
Right 1003844513 6:10159118-10159140 GGCATCTGGTGTGCTGCGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003844511 Original CRISPR CAGATGCCCAGCTCTCATTA AGG (reversed) Intronic
900478677 1:2887938-2887960 CTGAGGCCCAGCTCTCACTGAGG + Intergenic
900709221 1:4102083-4102105 CAGAGCCCCAGTTCTCACTAGGG + Intergenic
902800673 1:18827740-18827762 CACATGCACAGTTCTCAATAGGG - Intergenic
904630835 1:31840925-31840947 CAGAGGCCAAGCTGTCATCATGG + Intergenic
905663102 1:39743637-39743659 CTGAAGTCCAGCTCTCAGTAGGG - Intronic
906467133 1:46092243-46092265 TAGTTGCCCAGGTCTCATTCTGG - Intronic
907270341 1:53287527-53287549 CAGAAGCCCAGCTCTCCTGTGGG - Intronic
909046473 1:70716436-70716458 CAGATGCACAGCTCTTGTTTGGG - Intergenic
910254099 1:85230053-85230075 CACATGCACAGTTCACATTAGGG - Intergenic
911532743 1:99065095-99065117 GAGATGCCCAGTTTGCATTAAGG - Intergenic
912953548 1:114136808-114136830 CATATGTCCAGCTCTCCTTCTGG + Intronic
913325037 1:117620730-117620752 CACATGCTCAGCTCACACTAGGG - Intronic
913579422 1:120211014-120211036 CATATGCCCAGTTCACAATAGGG - Intergenic
913628750 1:120687374-120687396 CATATGCCCAGTTCACAATAGGG + Intergenic
914430901 1:147619718-147619740 CAGGTGCCCAGCCTTCACTAGGG - Exonic
914561356 1:148822441-148822463 CATATGCCCAGTTCACAATAGGG - Intronic
914611478 1:149307767-149307789 CATATGCCCAGTTCACAATAGGG + Intergenic
915447781 1:155983948-155983970 CCCTTGCCCAGCTCTCCTTAGGG + Intronic
920940658 1:210478902-210478924 CAGATGCTTGTCTCTCATTATGG - Intronic
921368784 1:214400853-214400875 CACATGGGCAGTTCTCATTAAGG + Intronic
923461497 1:234213364-234213386 CAGATGCCCAGCCATCAGTGTGG - Intronic
923521585 1:234739090-234739112 GAGATGACCAGCTCTCACTTAGG - Intergenic
924583196 1:245339476-245339498 CAGTAGCCCAGAACTCATTAAGG + Intronic
924609894 1:245564846-245564868 CACATGCACAGCTCACAATAGGG + Intronic
924666658 1:246080359-246080381 CACATGCCCAGTTCACAATAGGG - Intronic
1063316820 10:5014910-5014932 CAGATGCAAGGCTCTCATAAGGG + Intronic
1063460862 10:6214255-6214277 CACATGCCCAGTTCACAATAGGG - Intronic
1069569306 10:69484821-69484843 ACGAGGCCCAGCTCTCCTTATGG + Intronic
1069594342 10:69660937-69660959 CAGATGCCCTGCTTTCTTTCAGG - Intergenic
1072294420 10:93995188-93995210 CAGGTGCCCAGTTGTCATTGAGG + Intronic
1072373019 10:94784877-94784899 ACCATGCCCAGCTCTCATTGTGG + Intronic
1073199249 10:101721590-101721612 CAAATGCCCAGGTGTCATTCTGG - Intergenic
1074357673 10:112800336-112800358 CAGATGCCCAGGGCTCAACAGGG - Intronic
1075216424 10:120540201-120540223 CAGCTGCCCAGCTCTCCCCAGGG + Intronic
1076647811 10:131965411-131965433 CAGACCCCCATCACTCATTAAGG + Intergenic
1076670856 10:132120444-132120466 CAGCTGCCCAGGCCTCATCAGGG + Intronic
1077860833 11:6178375-6178397 CACATGCTCAGTTCTCAATAGGG - Intergenic
1079331450 11:19536257-19536279 CAGAGGCCCAGCTGACATTTTGG + Intronic
1081615835 11:44590757-44590779 CTGAGGCTCAGCTCTCAGTATGG + Intronic
1081689325 11:45066216-45066238 GAGATGCTCAGTTCTCATGATGG - Intergenic
1081723968 11:45313522-45313544 CTGGTGACCAGCTCTCATTCAGG - Intergenic
1083022124 11:59517907-59517929 CAGATGCCAAGCTCTCAAATGGG + Intergenic
1084620667 11:70268408-70268430 CAAATTTCCAGCTCTCCTTAGGG - Intergenic
1084711921 11:70848925-70848947 CAGAGGCCCAGCTGTCTGTATGG - Intronic
1086725203 11:90173821-90173843 CAGATCCCCAGCCCTGATGATGG + Exonic
1087284235 11:96247486-96247508 CAGATGCCAATCTATCATTCTGG - Intronic
1088482082 11:110303866-110303888 CACATGCACAGCTCACAGTAGGG - Intergenic
1091858158 12:3755620-3755642 CACATGCACAGTTCTCAATAGGG + Intronic
1093428050 12:19051629-19051651 CAGATGCCATCTTCTCATTAGGG + Intergenic
1095465833 12:42487321-42487343 CAGATACCAAGCTCTTCTTAGGG + Intronic
1098617693 12:72550251-72550273 CAGATGCCAATCTGTAATTATGG + Intronic
1102262105 12:111449385-111449407 CAGATTCCCAGCTTCCATTTTGG - Exonic
1103501312 12:121404933-121404955 CAGCAGCCCAGCTCTCTTTCTGG - Intronic
1104759825 12:131290112-131290134 CAGAGGCCCAGGTCACATCAGGG - Intergenic
1104809584 12:131612253-131612275 CACAGGCGCAGTTCTCATTAGGG + Intergenic
1104820902 12:131677137-131677159 CAGAGGCCCAGGTCACATCAGGG + Intergenic
1105423640 13:20274731-20274753 CATATGCCCAGATCTCTTTCTGG - Intergenic
1111756547 13:92403490-92403512 CACATGCGCAGCTCACAATAGGG - Intronic
1112367738 13:98770098-98770120 CAGGTGTCCAGCTCTTATTTTGG + Intergenic
1113078963 13:106496542-106496564 CACATGCCCACCACTCATTCTGG + Intronic
1113907549 13:113826814-113826836 CAGAGGCCCACCTCTCAGGATGG - Intronic
1115308581 14:31957159-31957181 CACATGCTCAGCTCACAATAGGG - Intergenic
1115485034 14:33901983-33902005 CATCTGCTCAGCTCTCAGTAGGG - Intergenic
1115504945 14:34084988-34085010 CAGGTGCCCAGTTCTCTTGATGG + Intronic
1117976872 14:61307562-61307584 CAGATACTCAGCTCTGATTCTGG + Intronic
1119906913 14:78313869-78313891 AAGATGTCTAGCTCTCGTTATGG + Intronic
1121518012 14:94566567-94566589 CAGATGCCCTCCTCTCATCATGG + Intronic
1122982487 14:105197921-105197943 CAGGTGCAGAGCTGTCATTAGGG + Intergenic
1124864473 15:33475463-33475485 CACGTGCACAGCTCACATTAAGG + Intronic
1125326480 15:38540714-38540736 GAGATGCCCAGATATCTTTAAGG + Intronic
1125441924 15:39712148-39712170 CTGCTGCCTAACTCTCATTAGGG + Intronic
1126674562 15:51148435-51148457 CAAACACCCAGCTCACATTATGG + Intergenic
1135264239 16:21008655-21008677 CAGCTGCCCAGCCATCATCATGG + Intronic
1135809672 16:25575990-25576012 CAGAGGCCCAGCTGTCATGTGGG - Intergenic
1137457981 16:48632762-48632784 CAAATGCTCAGCTCTCTTTCTGG - Intergenic
1137482587 16:48864935-48864957 CAAATGCCCAGCTCTTCTGATGG - Intergenic
1138513317 16:57521380-57521402 CAAGTGCCCAGCTCACATTGTGG + Intronic
1138513759 16:57524360-57524382 CAAGTGCCCAGCTCACATTGTGG - Intronic
1139329802 16:66178439-66178461 CAGATGACCAGCTTTCAATTGGG + Intergenic
1140703609 16:77605580-77605602 CAAATGTCCAGTTCTCATGAAGG + Intergenic
1141119961 16:81345935-81345957 CACATGCCCAGTTCACAATAGGG + Intronic
1141834408 16:86529187-86529209 CAGTAGCCCAGCTCTCACTGCGG - Intergenic
1143265267 17:5632183-5632205 CAGACTTCCATCTCTCATTAGGG + Intergenic
1144267147 17:13581054-13581076 CAAATGCAAAGCTCACATTATGG + Intronic
1146891421 17:36508779-36508801 CAGAGACCCAGCTCTAATTGTGG - Intronic
1149391703 17:56198024-56198046 CACATGCACAGTTCACATTAGGG - Intronic
1150208567 17:63428322-63428344 CAGCTGCCTAGCTCTCTATATGG - Intergenic
1153150234 18:2084291-2084313 CAGCTGCACAACTATCATTATGG + Intergenic
1153205596 18:2696412-2696434 CACATGCACAGTTCACATTAGGG - Intronic
1154155791 18:11943260-11943282 ACCATGCCCGGCTCTCATTATGG - Intergenic
1161095055 19:2385323-2385345 CAGCTGCCCAGTTCTGCTTAGGG + Intergenic
1164858053 19:31540323-31540345 CTGATTCCAAGCTCTCATGAGGG - Intergenic
1165671110 19:37680157-37680179 CACATGCACAGCTCACAATAGGG + Intronic
926290716 2:11527542-11527564 CAGATGCCCAGGTCCCACTCTGG - Intergenic
926636795 2:15188976-15188998 CAGATTCCCAGGTCCCAGTATGG + Intronic
926791679 2:16578127-16578149 CAGATCCCCAGCTCTGGTAAAGG + Intronic
927653219 2:24924693-24924715 GAGGTGCTCAGCTCTCATCAAGG - Intergenic
930018402 2:46986391-46986413 CAGATGCCCCGCCCTCACTGCGG + Intronic
930731544 2:54733036-54733058 CAGATGCCTACCTCCCTTTAGGG - Intronic
931851775 2:66258370-66258392 CAGATGCCCAGGTCTAATGGAGG + Intergenic
934968176 2:98741283-98741305 CAAATTTCCAGATCTCATTAAGG + Intergenic
935655681 2:105420782-105420804 CACATGTGCAGCTCACATTAGGG + Intronic
941733390 2:168945100-168945122 CAGATCCACAGCTTACATTAGGG - Intronic
945458173 2:210072625-210072647 CAGATGCACAGTTCACAATAGGG + Intronic
1172606664 20:36218834-36218856 CAGATGGCCAGCTCTCAGCCGGG - Intronic
1175451151 20:59069691-59069713 GAGATGCCCAGTTCTAATTCTGG + Intergenic
1181582398 22:23835455-23835477 CAGAGGCAGAGCTCTGATTAGGG + Intronic
1181679368 22:24481854-24481876 CCAATGCCCAGCTCTCAGTAAGG - Intergenic
1183594489 22:38802424-38802446 CAAATCCCCAGCTCTCAGTATGG + Intergenic
1184431950 22:44446259-44446281 CATATGCCCAGCACCCACTAAGG + Intergenic
952001839 3:28794836-28794858 CAGTTTGGCAGCTCTCATTAAGG - Intergenic
952901634 3:38115207-38115229 CAGATGCCCTGCTCTCATCAGGG + Intronic
954214522 3:49117041-49117063 CAGGTGCCCAGCTCTCACCTGGG + Exonic
957550326 3:81695926-81695948 CAGAGACCCCCCTCTCATTAGGG - Intronic
959805852 3:110552849-110552871 CAGATACCCAGCTCTCTTATAGG - Intergenic
963380628 3:144525327-144525349 CAGATGCCCAGCTAAGATTTGGG + Intergenic
965180126 3:165391867-165391889 CTGCTGCCCAGCTGTCATTTTGG + Intergenic
965180155 3:165392327-165392349 CTGCTGCCCAGCTGTCATTTTGG + Intergenic
966750515 3:183317315-183317337 CAGAAGCCCAGTTTTCAATAGGG - Intronic
969147396 4:5136160-5136182 CAAAAACCCAGCTCTCCTTAGGG - Intronic
969264377 4:6055479-6055501 CAGAGGCCCAGTTCCCATTATGG + Intronic
970698847 4:18710562-18710584 CTGATACACAGCTCTTATTATGG - Intergenic
970974443 4:22027056-22027078 CAGATGGCCAGCTCAGATTTGGG - Intergenic
971060862 4:22967621-22967643 CAGAAGCCCAGTTCTCAGTTTGG + Intergenic
971188381 4:24402925-24402947 ATGATGCCTGGCTCTCATTAGGG + Intergenic
971257637 4:25029607-25029629 CAAATGACCAGCTCTCACAAGGG - Intronic
972888319 4:43521247-43521269 CAGATGCCCATCACTTAATAAGG + Intergenic
977213064 4:94243450-94243472 CAGATACCCAGATCACATAACGG + Intronic
978803000 4:112772979-112773001 CAGATTCTAAGCTCTCATTCTGG - Intergenic
978868939 4:113550979-113551001 CAGATGTCCAGCTGATATTAAGG - Intronic
979542504 4:121901408-121901430 CAGATGCCTAGCTCTCTCTGCGG - Intronic
984638657 4:182141085-182141107 CAGATGCGCAGCTCTCCAAAAGG - Intergenic
985158407 4:187017811-187017833 CAAATTCTCAGCTCTCATTTTGG - Intergenic
987432908 5:17858399-17858421 CAAATTCCCAGCTCTCATATAGG + Intergenic
988589498 5:32536542-32536564 CACATGCGCAGCTCACAATAGGG - Intronic
988779859 5:34510507-34510529 CACATGGCCAGCTCTCAATATGG - Intergenic
992988039 5:82253744-82253766 CAGATGCGCAGTTCACAATAGGG - Intronic
994503759 5:100613598-100613620 CACATGCCCAGTTCACAATAGGG - Intergenic
997098153 5:130937303-130937325 CAGATGCACAGTTCCCAATAGGG - Intergenic
1000176116 5:158756146-158756168 CAGATTCCAGGCTCTCATTCTGG + Intronic
1003844511 6:10159103-10159125 CAGATGCCCAGCTCTCATTAAGG - Intronic
1005874263 6:29999305-29999327 AAGATGCCCAACTCTCAACAAGG + Intergenic
1006944270 6:37774466-37774488 CTGCTGCCCAGCTCTCATCCTGG - Intergenic
1010120899 6:72374946-72374968 CAGATGCACAGTTCACAATAGGG + Intronic
1010134549 6:72535446-72535468 AAGGTGCCCAGCTCTCTTTCTGG - Intergenic
1018788070 6:167123731-167123753 CAGTTGCAAAGCTCTCATGAGGG + Intronic
1018894337 6:168002917-168002939 CACATGCACAGCTCACAGTAGGG + Intronic
1018968122 6:168504470-168504492 CAGATGCGCAGTTCACAATAGGG + Intronic
1019321559 7:417878-417900 CAGAGGTCCAGCTCTCAGTGTGG + Intergenic
1020250785 7:6466779-6466801 CAGATGCACAGTTCACAATAGGG + Intronic
1023324124 7:39034039-39034061 CGTCTGCCCTGCTCTCATTATGG + Intronic
1023896140 7:44434454-44434476 CTGCTGCCCAGCTCTCACTGAGG + Intronic
1027520836 7:79204396-79204418 TAGAAGCCTAGCACTCATTATGG - Intronic
1030732359 7:113005218-113005240 CAAATGTCCAGCTCTAATTTTGG - Intergenic
1033399185 7:141005686-141005708 CAGAAGCCCAAATCACATTAGGG - Intergenic
1034485491 7:151358518-151358540 CACATGCCCAGTTCACAATAGGG - Intronic
1036736016 8:11317476-11317498 CACATGCGCAGCTCACAGTAGGG + Intronic
1037062685 8:14534641-14534663 CAGATGGCCAGTTTTGATTAAGG - Intronic
1039238316 8:35527300-35527322 CAGATGCCCATCTTTCAGGAAGG - Intronic
1044246822 8:89958088-89958110 CACATGCACAGCTCACAATAGGG + Intronic
1044990344 8:97790036-97790058 CAAATGACAAGATCTCATTATGG + Intronic
1048637585 8:136314806-136314828 CAGAAGCCCAGCTTTAATTAAGG - Intergenic
1051507307 9:17840987-17841009 CAGATGGGCAGCTCTCACTTAGG - Intergenic
1057029261 9:91761492-91761514 CAGATGCACAGTTCACAATAGGG + Intronic
1057142951 9:92738549-92738571 CTGATGGCCAGCTCTTATTGTGG - Intronic
1058742351 9:107956389-107956411 CATATGCCCAGCACTCAGTTAGG - Intergenic
1058869567 9:109190585-109190607 CAGATGCCCTGGTCTCAGTCTGG - Intronic
1058905277 9:109477739-109477761 CTGATGACCAGCTCTCCTTCCGG + Intronic
1060061493 9:120464272-120464294 CAGGTGCCCAGCCCTCACTTTGG - Intronic
1190751220 X:53363312-53363334 CAGATCTCCAGCTCTCACCATGG - Intergenic
1192557265 X:72100651-72100673 CACATGCACAGCTCACAGTAGGG - Intergenic
1194014860 X:88606372-88606394 CAGATTCCCACTTCTCATCATGG - Intergenic
1196006521 X:110843167-110843189 CAGATGCCCTGCTCTCAGCTTGG - Intergenic
1196579113 X:117358888-117358910 CAGATGACAAGCTCTCATCTGGG + Intergenic
1197705232 X:129630088-129630110 CAGCTCCCCAGCTCTCACTGGGG - Intergenic
1200362430 X:155622849-155622871 CAGATATCCAGCATTCATTAAGG + Intronic