ID: 1003844513

View in Genome Browser
Species Human (GRCh38)
Location 6:10159118-10159140
Sequence GGCATCTGGTGTGCTGCGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003844511_1003844513 -8 Left 1003844511 6:10159103-10159125 CCTTAATGAGAGCTGGGCATCTG 0: 1
1: 0
2: 1
3: 6
4: 168
Right 1003844513 6:10159118-10159140 GGCATCTGGTGTGCTGCGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003844513 Original CRISPR GGCATCTGGTGTGCTGCGCC AGG Intronic
No off target data available for this crispr