ID: 1003846932

View in Genome Browser
Species Human (GRCh38)
Location 6:10183390-10183412
Sequence AAGAACAAGGAAAAGTAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 920
Summary {0: 1, 1: 0, 2: 2, 3: 53, 4: 864}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003846929_1003846932 -1 Left 1003846929 6:10183368-10183390 CCTCCTGAGGCTGGCTGCAGAGA 0: 1
1: 0
2: 1
3: 40
4: 278
Right 1003846932 6:10183390-10183412 AAGAACAAGGAAAAGTAATCAGG 0: 1
1: 0
2: 2
3: 53
4: 864
1003846930_1003846932 -4 Left 1003846930 6:10183371-10183393 CCTGAGGCTGGCTGCAGAGAAGA 0: 1
1: 0
2: 2
3: 62
4: 373
Right 1003846932 6:10183390-10183412 AAGAACAAGGAAAAGTAATCAGG 0: 1
1: 0
2: 2
3: 53
4: 864

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003846932 Original CRISPR AAGAACAAGGAAAAGTAATC AGG Intronic
900111751 1:1009684-1009706 AAAAAAAAAGAAAAGAAATCAGG + Intergenic
900261408 1:1731916-1731938 AAAAAAAAGGAAAAATAATTGGG + Intronic
901295523 1:8158232-8158254 AAGAACACAGATAAGCAATCAGG - Intergenic
901515758 1:9744748-9744770 AAGAAAAAAAAAAAGTAAACTGG - Intronic
901845156 1:11977348-11977370 AACAACAACAAAAAGTAATATGG + Intergenic
903196850 1:21696447-21696469 AAGAAGAAGGGAAAGAAAGCGGG + Intronic
903536275 1:24068384-24068406 CAGAACAGGGAAAAGGACTCTGG - Intronic
903992523 1:27283605-27283627 AAGAACATGGAAGAGAAATGAGG - Intronic
904228320 1:29043855-29043877 AAAGACAGGGAAAAGTAGTCAGG + Intronic
904527416 1:31144301-31144323 AAGAAAAAGAAAAAGAAATAGGG + Intergenic
905711916 1:40112154-40112176 AAGTCCTAGGAAAAGCAATCAGG + Intergenic
905904100 1:41605221-41605243 AGGAAGAAAGAAAAGAAATCAGG + Intronic
906511518 1:46412814-46412836 AAGGAAAAGGAAAAGAAAACAGG + Intronic
906564388 1:46788063-46788085 AAGAAAAAGAAAAAGTCATACGG + Intronic
907632420 1:56095904-56095926 AAGTACAAGGAAAAGTCAGAAGG + Intergenic
907775072 1:57506328-57506350 AAGAATAAGCAAAACTGATCAGG - Intronic
907775701 1:57512407-57512429 GAGAACAAAGAAAAGAAATCTGG + Intronic
907977875 1:59449806-59449828 AAAAAAAAGAAAAAGTAATCTGG + Intronic
908994221 1:70132422-70132444 AAGAAAAAAGAAAAGTACTCTGG - Intronic
909250896 1:73354794-73354816 AAGAATAAGGAAAAATATTTGGG + Intergenic
909715326 1:78701172-78701194 AAGAACAAGCACAAGAATTCTGG - Intergenic
909727412 1:78851989-78852011 AAGAACAAGGCAAAGGAACAGGG + Intergenic
910129279 1:83884295-83884317 AAGCACAGGAAAAAGTATTCAGG + Intronic
910198289 1:84668807-84668829 AAAAATAAGGAAAAGTAAACGGG + Intronic
910204819 1:84738617-84738639 AAGAAGAAGGAAGAGAAATAAGG - Intergenic
910677972 1:89833888-89833910 AAAACCAAGGAAAAGGAATTTGG - Intronic
910830397 1:91455336-91455358 AAGAATAAGGATAACTAACCAGG + Intergenic
911048241 1:93647117-93647139 TAAAACAAGGTAAAGGAATCAGG + Intronic
911704563 1:100996456-100996478 AAGACAAGGGAAAAGTAATGCGG - Intronic
911826061 1:102486313-102486335 AAGAAGAGGGAAAAGTAAAGGGG + Intergenic
911882432 1:103257868-103257890 TAGAATAGGGAAAAGTAATAAGG - Intergenic
912191573 1:107347017-107347039 AAGAACAAGGCAAAGCAAGCAGG + Intronic
913060304 1:115198358-115198380 TAAAACAAGGAACAGTAACCTGG - Intergenic
913201654 1:116499464-116499486 AAGAAAAAGAAAAAAAAATCAGG - Intergenic
913322408 1:117598217-117598239 AGGAACATGGAGAAGTCATCTGG - Intergenic
913374970 1:118140981-118141003 AAGAGCAAGGGAAAATATTCAGG - Intronic
913496604 1:119433519-119433541 AAGAACAAGGAAACCTGACCTGG + Intergenic
913615376 1:120554555-120554577 AAAAAAGAGGAAAAGCAATCAGG + Intergenic
914330444 1:146664903-146664925 AAGGAAAAGGAAAAGAAATAAGG + Intergenic
914574900 1:148956352-148956374 AAAAAAGAGGAAAAGCAATCAGG - Intronic
915043195 1:152985483-152985505 AAGACCAAGCAGAAGTAATGTGG + Exonic
915044845 1:153003513-153003535 AAGACCAAGCAGAAGTAATTTGG + Exonic
915047736 1:153032598-153032620 AAGACCAAGCAGAAGTAATGTGG + Exonic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
916745995 1:167685334-167685356 AAGAGCAAGGAAATGGAAACTGG - Intronic
916782375 1:168049052-168049074 AAGAACATGGAACAGTAAATGGG + Intronic
917001060 1:170359927-170359949 AAGAACAACAAAAATTTATCAGG - Intergenic
917136676 1:171794759-171794781 AAGAACAGGCAAAATTAAGCTGG - Intronic
917424841 1:174902788-174902810 GAGAACAAAGAAAAGTAGTGTGG - Intronic
917544886 1:175954125-175954147 AAGAATAACAAAAAGAAATCTGG + Intronic
917713236 1:177708731-177708753 AAGATGAAGGAAAAGTTATTGGG - Intergenic
917952494 1:180054572-180054594 AATGATAAGGAAAAGAAATCAGG - Intronic
917986868 1:180329293-180329315 AACAAAAAGCAAAAGTAGTCTGG - Intronic
919013267 1:191992961-191992983 AAGATCAAATAAGAGTAATCGGG - Intergenic
919067021 1:192705331-192705353 AAGAAGAAAGAAAAGTACTGAGG - Intergenic
919109562 1:193200726-193200748 AAGAAACAGAAAAAATAATCTGG - Intronic
919526712 1:198662611-198662633 AAAAAAAGGGAAAAGTAATTAGG + Intronic
920540341 1:206773470-206773492 AATAACAAGGAAAAGAAGTCAGG + Intergenic
920549322 1:206845446-206845468 AAGAGAAAGGAAAAGTAGACGGG - Intergenic
920555702 1:206902733-206902755 AAGAACAAGGGAAAGACATATGG - Intronic
920594933 1:207259526-207259548 AAGCAGAAGGAAAAGTAAAGGGG - Intergenic
921105144 1:211969526-211969548 AAGAAAAAGAAAAAGAAATTTGG - Intronic
921112663 1:212054290-212054312 AAGAACAAGGAAAAGGAGACTGG - Intronic
921305925 1:213796798-213796820 AAGAAGAGGGGAAAGAAATCGGG - Intergenic
922140913 1:222885456-222885478 AAAAAAAAAGAAAAGAAATCAGG - Intronic
922562533 1:226579620-226579642 AAGAAAAAGAAAAAGAAATAAGG - Intronic
922953583 1:229579996-229580018 AAGAAAAAGGTAAAGCAATTTGG - Intergenic
924154285 1:241160135-241160157 AAGAAAAAGAAAAAGAAATAGGG + Intronic
924844152 1:247748569-247748591 AAGAACAATAACAGGTAATCCGG - Intergenic
1062784356 10:250070-250092 AAGAACATGGAAAAGTTATTCGG - Intronic
1063304588 10:4885691-4885713 GAGAAAAACGAAAAGTAAACAGG + Intergenic
1063441403 10:6076198-6076220 AAGAAGAAAAAAAAGAAATCTGG + Intergenic
1063588253 10:7372429-7372451 AAGAAAAAGAAAAAGCTATCAGG + Intronic
1064854514 10:19750660-19750682 AAGAAGGAGGAAAAGTAAAATGG - Intronic
1065206763 10:23364343-23364365 AACAACAACAAAAAATAATCAGG + Intergenic
1065215390 10:23443474-23443496 AAGAAAAAAGAAAAGAAATCAGG - Intergenic
1066272884 10:33840570-33840592 AAAAAAAAAAAAAAGTAATCAGG - Intergenic
1067248201 10:44564235-44564257 AAGAATAGGGAAAAATAAACAGG - Intergenic
1067274396 10:44821316-44821338 AAGCAGAAGGAAAAGAAAACTGG - Intergenic
1067894640 10:50165773-50165795 CAGAACAAGGACAAGAATTCAGG + Intergenic
1068231906 10:54178612-54178634 AAGAACAATGAAAAGAAGTGGGG + Intronic
1068546987 10:58358748-58358770 AAGAAAAAGAAAAAGCAATAAGG - Intronic
1068640925 10:59406424-59406446 AAGTACAAGAAAAATTAGTCGGG + Intergenic
1068765508 10:60758776-60758798 AAAAAAAAGGAAAATGAATCAGG + Intergenic
1069009191 10:63352327-63352349 AATAAAAAGGATAAGTAAACTGG + Intronic
1069737298 10:70665251-70665273 AAGAAAAAGAAAAAGAAAACTGG - Intergenic
1069915346 10:71783653-71783675 AACATCAAGGAAAGGAAATCAGG + Intronic
1070280701 10:75046141-75046163 AAGAAAAAGAAAAATCAATCTGG + Intronic
1070408870 10:76121031-76121053 AAGATAAAGAAAAAGCAATCCGG - Intronic
1070955888 10:80463192-80463214 TAGAACAAGGCAGAGTAATGGGG - Intronic
1071114348 10:82199802-82199824 AAAAAAAAAGAAATGTAATCTGG - Intronic
1071163086 10:82774794-82774816 AAGAAAAAGGAAAATAAAACTGG - Intronic
1071167447 10:82823028-82823050 CAGAAGAAGGAAAAGTAAAAGGG - Intronic
1071197229 10:83175522-83175544 AAGCAGAAGGAAAAGTAAAGGGG - Intergenic
1072042842 10:91625790-91625812 AAGAAAAAGAAAGAGTAATGAGG + Intergenic
1072047364 10:91670573-91670595 AAGAATAAAGAAAAGGATTCAGG + Intergenic
1072646731 10:97261747-97261769 AAGAAACAGGAAAAATACTCAGG + Intronic
1072907144 10:99464861-99464883 GAGAATAAGGAAAAGAAATTGGG - Intergenic
1073554065 10:104430786-104430808 AAGAAAATGTAAAAATAATCAGG + Intronic
1073638834 10:105229255-105229277 AAATGCAAGGAAAAGAAATCAGG - Intronic
1074934235 10:118161937-118161959 AAGAACAAGGGAAAGTCATTGGG + Intergenic
1075295706 10:121273128-121273150 AAGAAGAAGGAAAAGGCCTCTGG + Intergenic
1075302493 10:121337854-121337876 AAGAAGAAGAAGAAGTAATGTGG - Intergenic
1075837289 10:125465436-125465458 AATAACAATCAAAAGTAATACGG - Intergenic
1076049324 10:127320241-127320263 AAAAAAAAAGAAAAGGAATCTGG + Intronic
1076199671 10:128547918-128547940 AAGAACAAGGAATAATAAAAGGG - Intergenic
1076705207 10:132297653-132297675 AAGAAAAAGGAAAAAGAATTGGG + Intronic
1077792841 11:5460669-5460691 AAGAACCAGGGAAAGAATTCTGG - Intronic
1078623935 11:12935983-12936005 AAGAGCAAGGGAAACTAAACAGG + Intronic
1079056912 11:17214073-17214095 AAGAATAAGGAAGACAAATCTGG + Intronic
1079119893 11:17674465-17674487 AATAAGAAAGAAAAGCAATCAGG + Intergenic
1079341674 11:19616773-19616795 AAGAACCAGGAAAAGGAAAAAGG - Intronic
1079498990 11:21080936-21080958 AAGAACAAGTTAAAATAATAAGG - Intronic
1079564974 11:21871479-21871501 AAGAATAAGGAAAAATAACCAGG - Intergenic
1079955311 11:26855418-26855440 ACAAACAAGGAAAAATACTCTGG + Intergenic
1079991480 11:27251006-27251028 AAGAAAAAGGAAAAGAAAAAGGG + Intergenic
1080213674 11:29817121-29817143 AAGCAGAGGGAAAAGTAAACGGG - Intergenic
1080496233 11:32823108-32823130 AAGAAAAAGGAAAAGGAAAAAGG + Intergenic
1081348271 11:42017298-42017320 AAAAATAAAGAAAAATAATCAGG - Intergenic
1081352293 11:42069006-42069028 AAGAAGAAGGAAAAGAAGTGAGG + Intergenic
1081496561 11:43616991-43617013 AAGAAAAAGAAAAAAAAATCCGG + Intronic
1082904796 11:58294558-58294580 AAAAAAAAAAAAAAGTAATCTGG + Intergenic
1083464007 11:62833315-62833337 AAAAAAAAAGAAAAGTAGTCAGG + Intronic
1083577904 11:63805674-63805696 AAGAAAAAGAAAAAGAAATATGG - Intergenic
1084921689 11:72475905-72475927 AGGAACAAGGAAAAAAACTCTGG - Intergenic
1085194736 11:74662217-74662239 AAGAAGAGGGAAAAGTAAAGGGG - Intronic
1085474635 11:76782235-76782257 ATGAATAAGAAAAAGTAATAAGG + Intronic
1085604502 11:77885063-77885085 AAGAAAAAGAAAAAGAAATAAGG - Intronic
1086015864 11:82166807-82166829 ATCAACTAGGAAAAGTAATCAGG + Intergenic
1086940098 11:92787545-92787567 AAGAACAAGCAAGAATAACCAGG - Intronic
1087017115 11:93564596-93564618 AAGAAATAGAAAAAGAAATCCGG + Intergenic
1087128674 11:94650749-94650771 AAAACCAAGGAAAAGGACTCAGG - Intergenic
1087359219 11:97136753-97136775 AAGAACAGAGAAAAGTAAAGAGG - Intergenic
1087950820 11:104218766-104218788 AAGCACAGGGAAAAGTAAAGGGG - Intergenic
1088064618 11:105701020-105701042 AAGAACAAGCATAAGTTACCAGG - Intronic
1088224079 11:107599877-107599899 AACAACAATGAAAAGGAATTTGG - Intronic
1088539057 11:110894171-110894193 AAAAAGCAGGAAAAATAATCTGG - Intergenic
1088646760 11:111923785-111923807 AAAAACAAGGACAAGGAAGCAGG + Intronic
1088963643 11:114696034-114696056 AAGAAGAAGAAGAAGAAATCAGG + Intronic
1089040290 11:115442042-115442064 AACACCAAGGAAATGTAATATGG + Intronic
1089793914 11:120965175-120965197 AACAAGATGGAAAATTAATCAGG + Intronic
1089842347 11:121429112-121429134 AAGAAAAAGAAAAAGAAATAAGG - Intergenic
1090026936 11:123175617-123175639 AAGATAAAGGAAAAGCAAGCTGG - Intronic
1090116072 11:123975664-123975686 AAGGAGGAGGAAAAGTAAACAGG + Intergenic
1090318286 11:125817252-125817274 GAAAAGAAGGAAAAGTAAACGGG - Intergenic
1090586462 11:128218548-128218570 AAGAAAAAGGAAAATCATTCTGG - Intergenic
1091185144 11:133640302-133640324 GGGTACAAGGAAAAATAATCTGG - Intergenic
1091229057 11:133976043-133976065 AAGCAGAAGGAAAAGTCATGAGG - Intergenic
1091382831 12:73686-73708 AAGAAAAAGAAAAAGAAACCAGG + Intronic
1091383877 12:79589-79611 AAAAACAAAGAAAATTAGTCAGG - Intronic
1091592380 12:1851706-1851728 AAGAACAAGCAAGAATAACCAGG - Intronic
1092020766 12:5200627-5200649 AAGAACAAGGTAAATTGTTCTGG - Intergenic
1092818571 12:12332236-12332258 AAGAAAAAGGAAAAGAGAGCAGG - Intronic
1093030178 12:14281258-14281280 AAGAAGAAGAAAAAGAAATACGG - Intergenic
1093165597 12:15801813-15801835 AAGAACAAAGAAACCCAATCAGG + Intronic
1093272548 12:17082272-17082294 AAGAACAAAGAAGAGAAATAGGG - Intergenic
1093482649 12:19620648-19620670 AACAACAAGGAAAACACATCAGG - Intronic
1093627919 12:21372042-21372064 AAGAAAAAGAAAAAGCAATTTGG + Intronic
1094314816 12:29127930-29127952 CAGATCAAGGAAAGTTAATCAGG - Intergenic
1094445890 12:30529640-30529662 AAAAACCAGAAAAAGTCATCTGG - Intergenic
1095200884 12:39382428-39382450 AAGAACAATTACAGGTAATCTGG + Intronic
1095213160 12:39517542-39517564 AAGAAAAAAGAAAGGAAATCAGG + Intergenic
1095376774 12:41539444-41539466 AAGAACAGAGAAAAGCAATTTGG + Intronic
1095710969 12:45287623-45287645 GAGAATAAGGAAAAGGAGTCAGG + Intronic
1096057336 12:48665029-48665051 AAGAAGAAAGAAAAATTATCTGG - Intronic
1096276216 12:50210447-50210469 AAGAACAACCAAAAGGAAACGGG + Intronic
1096976983 12:55705081-55705103 TAGAACAAGGATAACTTATCTGG - Intronic
1096978105 12:55711636-55711658 AAGAAAAAGAAAAAGAAATGTGG + Intronic
1097512718 12:60564405-60564427 AAGAACCAGCAAAAGAATTCTGG - Intergenic
1097524135 12:60709298-60709320 AAAAACAAAGAAAAGAAGTCAGG - Intergenic
1097623496 12:61971194-61971216 AAGAAAATGGAAATGTTATCTGG + Intronic
1097891065 12:64778461-64778483 AAGAACAAGGAAGAGAACTAAGG + Intergenic
1098405693 12:70123688-70123710 AAGCACAGGGAAAAGTAAAGGGG + Intergenic
1098724794 12:73949841-73949863 ATGAATAAGGAAAAATAATCAGG + Intergenic
1099210598 12:79783306-79783328 AAAAAAAAGGAAAATTAAACAGG + Intronic
1099356179 12:81638033-81638055 AATAACTAGGAAAAATAGTCGGG - Intronic
1099356183 12:81638101-81638123 AAGAAGAAGGAAGAATAATGAGG - Intronic
1099465947 12:82988301-82988323 GATAACAATGAAAAGAAATCTGG + Intronic
1099523323 12:83690192-83690214 AAGAACAGGGAAGAGTAAAGGGG + Intergenic
1099546268 12:83984117-83984139 AAGAAAAAGAAAAAGAAACCTGG + Intergenic
1099565618 12:84241984-84242006 AAGAAAAAGAAAAAGAAATGGGG - Intergenic
1099997943 12:89799582-89799604 AGGGGCAGGGAAAAGTAATCAGG + Intergenic
1100349323 12:93763939-93763961 TAGAACAACCAAAAGAAATCGGG - Intronic
1101041213 12:100757704-100757726 AAGAACAAAGAACAGTAGGCAGG - Intronic
1101226247 12:102690853-102690875 AAGAACAAGGTAAAGAAGTATGG - Intergenic
1101642536 12:106598184-106598206 TAGAAGAAGGAAAAGTTACCAGG - Intronic
1101662881 12:106782013-106782035 AAGAACAAGAAAAAGAAAGAAGG - Intronic
1103274861 12:119702932-119702954 AAAAACAACTAAAAATAATCAGG - Intronic
1103739624 12:123082368-123082390 AAGAAGAAAGAAAAGTAAGTCGG - Intronic
1103869241 12:124079328-124079350 ATGACCAAAGAAAAGAAATCAGG - Intronic
1104382956 12:128323890-128323912 AAGAACAAGGAAAGGCAAGGAGG + Intronic
1104583203 12:130026117-130026139 ATGACCAAGGAAGAGTAAACAGG - Intergenic
1105315141 13:19251925-19251947 AATAAAAATGAAAAGTAAGCAGG + Intergenic
1105430832 13:20335781-20335803 AAAAAAAAAAAAAAGTAATCAGG + Intergenic
1105661644 13:22502585-22502607 AAATACGAGGAAAAATAATCAGG + Intergenic
1106157690 13:27172517-27172539 AAGAAGAAAGATAAGTAATGGGG + Intergenic
1106179207 13:27356658-27356680 GAGAAGAATGAAAAATAATCTGG - Intergenic
1106338631 13:28807452-28807474 AAGATCAAGCATAAGTCATCTGG + Intergenic
1106896816 13:34312164-34312186 CAAAACCATGAAAAGTAATCAGG + Intergenic
1107038287 13:35922998-35923020 AGGAACAAGGAAAGGTAACCAGG - Intronic
1107263238 13:38520076-38520098 AAGAAAAGGGAAAAGTAAATGGG - Intergenic
1107824560 13:44316620-44316642 AAAAACAAGAAAAAGAAAACTGG - Intergenic
1108117149 13:47141454-47141476 AAGAAAAGGTAAAAGTAATTGGG + Intergenic
1108138005 13:47386106-47386128 AAGAAGAGGGAAAAGTAAAGAGG + Intergenic
1108884809 13:55166379-55166401 AAGAAAAAAGAAAAAGAATCCGG + Intergenic
1109021262 13:57095320-57095342 AAAAAAAAAGAAAAGTAACCAGG + Intergenic
1109487494 13:63046454-63046476 AAAAACAAGAAAAGATAATCAGG - Intergenic
1110011982 13:70348029-70348051 ACAAACAAGGTAAACTAATCTGG + Intergenic
1110030854 13:70611307-70611329 ATGAGCAAGGAAAAGAAAACAGG + Intergenic
1110390505 13:74968093-74968115 AAGAAGAAGGAAAGGGAATTGGG - Intergenic
1110536579 13:76657872-76657894 AGGACCAAGGTAATGTAATCGGG + Intergenic
1111143569 13:84153970-84153992 AAGAACCAGTAAAAGCATTCTGG - Intergenic
1111776884 13:92674678-92674700 AAGAAGAAGATAAAATAATCAGG - Intronic
1112114015 13:96333438-96333460 AAGACCAAGGAAAGGTGACCAGG + Intronic
1112393295 13:99004313-99004335 GAGAACAAGGAAAAGACCTCAGG + Intronic
1112449485 13:99495881-99495903 AAAAACAAGGAAAAGGACTCAGG + Intergenic
1112618881 13:101034715-101034737 AAGCAGAAGGAAAAGTAAAGGGG - Intergenic
1112968495 13:105229724-105229746 AAGAAAAAGAAAAAGAAAGCAGG - Intergenic
1113189147 13:107723570-107723592 AAAAATAAGAAAAAGTCATCAGG + Intronic
1113394005 13:109927147-109927169 CAGAACAAGGAAAATTACTGAGG + Intergenic
1113400340 13:109986656-109986678 AAGAAAAAAGAAAAGTAAAGAGG + Intergenic
1114369740 14:22073667-22073689 AAGAATAAAGAAAAATAAACAGG - Intergenic
1114584752 14:23800365-23800387 AAGAACATAAAAAAGGAATCAGG - Intergenic
1114847577 14:26342180-26342202 GAGAAAAAAGAAAAGTAATGTGG - Intergenic
1114852228 14:26395003-26395025 AAGAACAAGGATCATCAATCAGG - Intergenic
1115018754 14:28649326-28649348 AAAAAAAAAAAAAAGTAATCAGG - Intergenic
1115253175 14:31370512-31370534 AAGAACACTGAAAAATAATTTGG + Intronic
1115906134 14:38205290-38205312 AAGAAAAAGGAAAACTGATATGG - Intergenic
1116013375 14:39377447-39377469 AAAAAGAAGGAAAAGAAATAAGG + Intronic
1116242465 14:42362870-42362892 AAGAAAAATTAAAAGTAGTCAGG - Intergenic
1116705374 14:48290247-48290269 AAGAATAAGGAAATGAAATAAGG - Intergenic
1117739269 14:58799619-58799641 AAGAAAAAGAAAAAGAAATATGG - Intergenic
1117767079 14:59094507-59094529 AAGAGCACAGATAAGTAATCTGG + Intergenic
1117882384 14:60324947-60324969 AAGAAAAAGAAAAAGCAAACCGG - Intergenic
1118549372 14:66932604-66932626 AAGGAGAAGGAAAAGTAAAGAGG - Intronic
1118736576 14:68705469-68705491 AAGAACAAGGAAAGGTCAGCAGG + Intronic
1118924716 14:70181607-70181629 AAGAACAAGGACAAGTCTTAGGG + Intronic
1118980842 14:70715542-70715564 AAGAAAAAGAAAAATTAGTCGGG + Intergenic
1119335523 14:73830391-73830413 AAGAAGAAGGAGAAGAAATGAGG - Intergenic
1119580208 14:75771876-75771898 AAGAAAAAGGGAAAGTAAAAAGG - Intronic
1120409970 14:84142011-84142033 AAGACCAAAGAAAAAAAATCAGG + Intergenic
1120470276 14:84914856-84914878 AAGAAAAAGAAAAAGTTAACAGG - Intergenic
1120488536 14:85146835-85146857 AAGAAAAAAGAAAAATAAGCAGG + Intergenic
1120525976 14:85577580-85577602 AAGAAAAAAAAAAAATAATCAGG - Intronic
1121017123 14:90555631-90555653 AAGGGCAAGGAAAAGGACTCTGG - Intronic
1121140001 14:91533259-91533281 AAGAACAAGAAAATGTTATCAGG + Intergenic
1121187413 14:91987352-91987374 AAGGACAAGCCAAAGTAAGCTGG - Intronic
1121381127 14:93468283-93468305 AAGGACAAGGAAAAAAAATAGGG + Intronic
1121413175 14:93761826-93761848 AAGAACCAAGAAATGGAATCTGG - Intronic
1122221694 14:100243051-100243073 AATCACAAGGAAAAGTAAGGGGG - Intronic
1122473022 14:101984950-101984972 AAAAAAAAGGAAAAGAAATAGGG + Intronic
1122948325 14:105024839-105024861 AAGAAAAAAGAAAAGTATTAAGG + Intergenic
1123625669 15:22225323-22225345 AAGAAGAAAGAAAAGTTAGCCGG - Intergenic
1123678599 15:22738993-22739015 AAGTAGAAGGAAAAGGAATGAGG - Intergenic
1123821133 15:24031522-24031544 CAGAAAAAGGAAAAGGACTCAGG + Intergenic
1124330803 15:28813274-28813296 AAGTAGAAGGAAAAGGAATGAGG - Intergenic
1125176373 15:36826734-36826756 AAGATCACAGAAAAGGAATCAGG + Intergenic
1125253713 15:37737481-37737503 AAGGAGAAGGAAAAGCAAGCAGG - Intergenic
1125339097 15:38657053-38657075 AAAAAAAAGAAAAAGTAATTAGG + Intergenic
1125897686 15:43316288-43316310 AAGCCAAAGGAAGAGTAATCAGG + Intergenic
1126447947 15:48771033-48771055 AAGAAGAGGGAAAAGGAATGTGG - Intronic
1126509203 15:49448301-49448323 AAGAATAAGGAAAAGAAAAGAGG - Intronic
1126561777 15:50052044-50052066 AAAAACAAAGAAAAGTAGACTGG - Intronic
1126862597 15:52901554-52901576 AAGAATAAAGAAAGGTAATGAGG - Intergenic
1126866931 15:52947030-52947052 AAGAACAAAGACAAGTTCTCTGG - Intergenic
1127440587 15:59003106-59003128 AAGAAAAAAGAAAATTAAACAGG - Intronic
1127712134 15:61610001-61610023 AAGATCAAGGAAATCTAACCAGG + Intergenic
1128039385 15:64557293-64557315 GAGAACATTGAAAAATAATCAGG + Intronic
1128257251 15:66206339-66206361 AAGAAGAAGAAAAAGAAAGCAGG + Intronic
1128462645 15:67882916-67882938 TAAAACAGGGAAAAGGAATCAGG + Intergenic
1128714429 15:69897015-69897037 AACAAAAAGGAAAATTGATCAGG - Intergenic
1128743808 15:70100084-70100106 AAGAAGAAGGAAAAGAAAAGAGG + Intergenic
1128794498 15:70455300-70455322 GACAACAAGAAAAAATAATCGGG - Intergenic
1129015423 15:72463719-72463741 AAAAAAAAGGAAAAATAATAAGG - Intergenic
1129422587 15:75441001-75441023 AAGAACAAGAAAAAGAAACAGGG + Intronic
1129434886 15:75531256-75531278 AAGAACCAGCAAAACCAATCAGG + Intronic
1129858915 15:78845085-78845107 AAGAAAAAAGAAAAGAAAGCTGG - Intronic
1130573242 15:85068037-85068059 AAGAAAAAAAAAAAGAAATCTGG - Intronic
1130800394 15:87256751-87256773 AATAATAATGAAAAGAAATCAGG - Intergenic
1131106683 15:89739513-89739535 AAGCATAAGGAACAGTACTCAGG + Intronic
1131253193 15:90844300-90844322 ATGGACAAGGAGAAGTAATAAGG - Intergenic
1131431076 15:92389642-92389664 AAGAATATGGAAAAGTTAACGGG - Intergenic
1131465888 15:92654812-92654834 AAGAAGAAGAAAAAGTAGGCGGG + Intronic
1131689388 15:94810150-94810172 AAAAACTAAGAAAAATAATCGGG - Intergenic
1131919445 15:97307978-97308000 AAGAGCAAGGAAATTTATTCGGG - Intergenic
1133973548 16:10583913-10583935 AAGAACAAGAAAGAGTGAACAGG - Intergenic
1135051201 16:19194422-19194444 AAGACCAAGGAGAAGTACCCAGG - Intronic
1135111567 16:19694475-19694497 AAAAAAAAAGAAAAGAAATCAGG - Intronic
1135234786 16:20745126-20745148 AAGAACAAAGAAGAATAATAAGG - Intronic
1135326953 16:21532515-21532537 AAATACAACCAAAAGTAATCTGG - Intergenic
1135470591 16:22726268-22726290 AAGAAAAAGAAAAAGGAAGCGGG - Intergenic
1135805740 16:25540859-25540881 AAAAAGAAGGAAAAGGATTCTGG + Intergenic
1135898637 16:26434171-26434193 AAGAAAAAGGAAAAGAAAAAGGG - Intergenic
1136075071 16:27811638-27811660 AACAACAACGAAAAGAAACCAGG - Intronic
1136337211 16:29617925-29617947 AAATACAACCAAAAGTAATCTGG - Intergenic
1136646049 16:31616423-31616445 AAGAAAAAGGAAAAAAAATGGGG + Intergenic
1136789240 16:32954975-32954997 AAAAAAAAGGAAAAGAAAGCGGG - Intergenic
1136880573 16:33898963-33898985 AAAAAAAAGGAAAAGAAAGCGGG + Intergenic
1138396939 16:56711643-56711665 AGGAACAAGCAAAACTAATATGG - Intronic
1138806870 16:60100487-60100509 AAGGAGAGGGAAAAGTAAACAGG - Intergenic
1138970761 16:62140453-62140475 AAGAGCAAGGGAAAGTTTTCTGG + Intergenic
1139004270 16:62551536-62551558 AAGAACAAGGAAAGGAAAGGGGG - Intergenic
1139108108 16:63853288-63853310 AGGACTAAGTAAAAGTAATCTGG - Intergenic
1139150619 16:64377871-64377893 GAGAGAAAGGAAAAATAATCAGG + Intergenic
1139286137 16:65816079-65816101 AAAAAAAAGGAAAAGAAATTAGG - Intergenic
1140003114 16:71046003-71046025 AAGGAAAAGGAAAAGAAATAAGG - Intronic
1140118591 16:72064307-72064329 AAGGACAAGGAAACTTAAGCAGG - Intronic
1140524874 16:75614191-75614213 AAAAAAAAGGAAAAGAAATTTGG + Intronic
1140596197 16:76416970-76416992 AAGAACAAGGAAGATTACTTGGG - Intronic
1140771107 16:78204955-78204977 AAGAACAATTAAAAGTTATTTGG + Intronic
1140926498 16:79589493-79589515 AAGAAAAAAGAAAAAAAATCTGG + Intronic
1141109012 16:81256891-81256913 AAGAAAAAAAAAAAGTTATCAGG + Intronic
1142819255 17:2451707-2451729 AAGAGGAAGGAAGAGAAATCGGG + Intronic
1143252917 17:5536130-5536152 AAGAACAAGAAAAAGTCAGTGGG - Intronic
1143509074 17:7385380-7385402 AAGAAGAAGAAGAAGTAATGAGG + Intronic
1143821918 17:9571606-9571628 AAAAAAAAAAAAAAGTAATCTGG + Intronic
1143993094 17:10983777-10983799 AAGGACAAATAAAAATAATCTGG + Intergenic
1144058587 17:11561737-11561759 AAGACCAGGGAAAAGAAATTAGG - Exonic
1144396786 17:14852016-14852038 AAAAACAAGGAATGGCAATCTGG - Intergenic
1144516692 17:15922999-15923021 AAGAAAAAGAAAAAGAAATATGG - Intergenic
1144552705 17:16255444-16255466 CTGAACAAGGAAATATAATCTGG + Intronic
1144647301 17:16984050-16984072 GAGAAGAAGCAAAAGTAAACAGG - Intergenic
1146191497 17:30771500-30771522 AAGAACCAGGGAAAGTAACTAGG + Intronic
1146336660 17:31978157-31978179 AAGAACCAGGGAAAGTAACTAGG + Intronic
1146559930 17:33859357-33859379 AAGAACCAGGAAAAGAAAGGAGG + Intronic
1147241117 17:39091138-39091160 AAAAGCAAGAAACAGTAATCAGG - Intronic
1148053064 17:44778733-44778755 AAGAAAAGAGAAAAGAAATCAGG + Intronic
1148516154 17:48219759-48219781 ATGAACAAGAAAAGGTTATCTGG + Intronic
1148668714 17:49394108-49394130 AACAATAAGGAACAGAAATCTGG + Intronic
1148909887 17:50935745-50935767 AATAACAAGGAAAAATAATCAGG + Intergenic
1148996981 17:51719261-51719283 AAGAACAAGGAGGAGCCATCTGG - Intronic
1149015190 17:51901101-51901123 AAGAACCAGGATAAGAACTCTGG - Intronic
1149052104 17:52318003-52318025 AAGAAAAAGAAAAAGATATCTGG + Intergenic
1149095332 17:52833131-52833153 AAGAAGAAAGAAAAGTAAAGGGG + Intergenic
1149325644 17:55527199-55527221 AAGAGAAAGGAAAAGTTATATGG + Intergenic
1149632229 17:58135859-58135881 TTGAATAAGGAAAAGTAATCTGG + Intergenic
1149668278 17:58381851-58381873 AAGAGAAAGGAAAAATAATTTGG - Intronic
1149856429 17:60087118-60087140 ATGAAGCAGGAAAAGTAAGCAGG + Intergenic
1149972424 17:61232220-61232242 AAGAAAGAGAAAAAGAAATCAGG + Intronic
1150176632 17:63064095-63064117 ATGAAAAAGTAAAAGTAATTTGG + Intronic
1150257258 17:63757384-63757406 AAAAAAAAGGAAAAGAAAACAGG + Intronic
1150618460 17:66790293-66790315 AAGAAAAACTAAAATTAATCAGG + Intronic
1151825930 17:76524227-76524249 AAGAAAAAGGAAAAGAAAAGAGG - Intergenic
1152653285 17:81506670-81506692 AAGAAAAAGAAAAAGAAATATGG + Intergenic
1153197360 18:2615204-2615226 AACAACAAGAAAAAATAATGTGG + Intronic
1155024100 18:21925701-21925723 CAGAACAAAGAAAAAAAATCTGG - Intergenic
1155035673 18:22022930-22022952 AAGAAAAAGGGAAAGAAGTCGGG + Intergenic
1155090528 18:22504771-22504793 TAGGACAAGGAAAAGAACTCAGG + Intergenic
1155686055 18:28552254-28552276 AACAACAAGGCAAAATAATAAGG - Intergenic
1155883504 18:31179469-31179491 AAGGATAAGGAAAAGAAATAAGG - Intergenic
1156155823 18:34300808-34300830 AAGCAAAAGGAAAAGTAAAGGGG + Intergenic
1156558338 18:38092726-38092748 AGGATCAAAGAAAAGTAGTCAGG - Intergenic
1156576741 18:38325874-38325896 AATATGAAGGAAAAGTATTCTGG - Intergenic
1156619070 18:38827242-38827264 CATGACAAGGAAAATTAATCAGG - Intergenic
1156711233 18:39948565-39948587 AAGAAGAACAAACAGTAATCTGG - Intergenic
1156787678 18:40935176-40935198 AAGAATGAGGAAAAGAAGTCAGG + Intergenic
1157254173 18:46123463-46123485 AAGGTAAAGGAAAAGAAATCAGG - Intronic
1157627572 18:49063294-49063316 AAAAAAAAAGAAAAGAAATCTGG - Intronic
1157770661 18:50343005-50343027 AAGAGCAAGGAAAATTATTAGGG - Intergenic
1157990026 18:52483886-52483908 AAGATCAAAGAATAGTAAACAGG - Intronic
1158032799 18:52987202-52987224 AAGAAGTAGCAAAAGCAATCAGG + Intronic
1158188981 18:54803997-54804019 AAGAAGAGGGAGAAATAATCAGG - Intronic
1158790547 18:60775127-60775149 AAGAACCAGCAAAAGAACTCTGG + Intergenic
1159830393 18:73270942-73270964 AAGAATAGGGAAAACAAATCTGG - Intergenic
1161184262 19:2905874-2905896 AAAAACAAGGAAAAAAAATGAGG + Intronic
1162663807 19:12193194-12193216 AAGAAAAAGAAAAATTAATTGGG - Intergenic
1163037786 19:14581144-14581166 AACAACAAGGAACATTCATCAGG - Intergenic
1163365249 19:16872424-16872446 AAGAAGAAGAAAAAGAAATCAGG - Intronic
1163658322 19:18561254-18561276 AAAAACAAGGTAAAGTAGCCTGG + Intronic
1163669974 19:18621723-18621745 AAGAAAAAGAAAAAGTAGACCGG - Intergenic
1163764001 19:19152403-19152425 AAGAAAAAGAAAAAGAAATCTGG + Intronic
1163888193 19:19988167-19988189 GAGAAGAAGGAAAAGCAATGTGG + Intergenic
1163914897 19:20232502-20232524 TAGAACAAAGAAAAGTGATGGGG + Intergenic
1163969700 19:20780328-20780350 TAGAACAAAGAAAAGAAATGGGG - Intronic
1164588505 19:29493077-29493099 AATCACAAGGAAAAGGAAACTGG + Intergenic
1164743400 19:30593716-30593738 AAGAACAGAGAAAAGCTATCAGG + Intronic
1164785243 19:30925332-30925354 AAATACAAAAAAAAGTAATCAGG + Intergenic
1164827353 19:31293445-31293467 AAGATCAAAGGAAAGTTATCAGG - Intronic
1165042239 19:33077032-33077054 AAGAAAAAGTAAAAGAAACCGGG - Intergenic
1166096179 19:40540832-40540854 AAAAAAAAAGAAAAGTAATTTGG + Intronic
1166197137 19:41214480-41214502 AAGAAAAAGGAAAAGAAAGCAGG - Intergenic
1166441863 19:42822710-42822732 CAGAAAAAGGAAATGTAATGGGG + Intronic
1166617973 19:44268332-44268354 AAGAAAAATGAAAAGAAAACAGG - Intronic
1166927193 19:46277198-46277220 AAGAAAAAGGAACATTAACCTGG + Intergenic
1167020845 19:46874351-46874373 AAGATCAAGTAAAAACAATCAGG - Intergenic
1167447339 19:49545522-49545544 AAGAACAGGCAAAACTAATCTGG + Intronic
1167633029 19:50637617-50637639 ATGGACAAGGAAAAGGAATTAGG + Exonic
1167834899 19:52060481-52060503 AAAAACGAGGAAAAGGACTCAGG - Intronic
924995092 2:352811-352833 AAGAAAAAGTAAAAATAATATGG + Intergenic
925507081 2:4579091-4579113 ATGAACAAGCAAACATAATCTGG - Intergenic
926472465 2:13278306-13278328 AAGAACAAGTACAAGAAAACTGG + Intergenic
927240596 2:20916862-20916884 AAGAACAAAGAAGTGTATTCTGG + Intergenic
928870954 2:35978647-35978669 AAAAAAAAGTAAAAGTAATTTGG - Intergenic
929057787 2:37893395-37893417 AAGAGAAAGGAAAAGCACTCTGG - Intergenic
929183660 2:39070400-39070422 AAGGACATGGAAAAGGAATAAGG - Intronic
929553068 2:42906541-42906563 AAGACCAGGGAAATGTAATGGGG - Intergenic
929732339 2:44509240-44509262 AAAAACAAAGAAAAATAATTAGG - Intronic
929956473 2:46462256-46462278 AAGAAGAAGGAAAACAAAACAGG + Intronic
930376923 2:50579486-50579508 AAAAACAAGCAAAATTAGTCAGG + Intronic
930534751 2:52631764-52631786 AAGAAAAAAGAAAAATTATCTGG - Intergenic
930658738 2:54033056-54033078 AAGCCCAAGGCAAACTAATCAGG + Intronic
931050026 2:58402403-58402425 AAGAACCATGAAAAAAAATCTGG + Intergenic
931930173 2:67123486-67123508 AAGAACAAGGACACATAATTAGG + Intergenic
932711251 2:74065538-74065560 AAAAACAAAAAAAAGAAATCAGG - Intronic
932744465 2:74321380-74321402 AAGAAGAAGGAAAAGTGAAGAGG - Intronic
933015645 2:77123017-77123039 AAGAACAAAGAAAAATGATTAGG + Intronic
933484413 2:82899829-82899851 AACAACAAAGAAAAGAAAACTGG - Intergenic
933495650 2:83047143-83047165 AAGAAAAGGGAAAAGTCATCAGG + Intergenic
933629687 2:84641609-84641631 AAGAACAAGGCAAGATATTCTGG + Intronic
935078623 2:99770516-99770538 AAGCAGAAGGAAAAGTAAAAGGG - Intronic
935401242 2:102662661-102662683 AAGGACAAGGAAAGGAAAGCAGG + Intronic
935804290 2:106730880-106730902 AATAACAACAAAAAGTAATAGGG + Intergenic
936587728 2:113773157-113773179 AAGAAAAAGAAAAAGAAATGGGG - Intergenic
938218782 2:129547224-129547246 AAGAACAGGCAAAACTAATATGG - Intergenic
938619266 2:133032082-133032104 AAGCAGAAGGAAAAGTAAAAAGG + Intronic
938871022 2:135476677-135476699 AAAAAAAAGGAAAAGAAATATGG - Intronic
939152923 2:138494520-138494542 AAGCACAGGGAAATGTAAGCAGG + Intergenic
939380318 2:141426787-141426809 TAAAACAAAGACAAGTAATCTGG + Intronic
939380842 2:141434612-141434634 AAATACAAGGAAAAATTATCAGG - Intronic
939903388 2:147879268-147879290 AAGATCAAGGCAAAGGCATCTGG + Intronic
939928244 2:148200701-148200723 AAAAAAAAAGAAATGTAATCTGG + Intronic
940695511 2:156972641-156972663 AAGAACACTGAAAAGCAAGCAGG - Intergenic
940699135 2:157020006-157020028 AAGAATAAGGTAAAATAATTGGG - Intergenic
940699319 2:157022216-157022238 AGCAACAAGTCAAAGTAATCTGG - Intergenic
941303316 2:163830125-163830147 AAGCAGAGGGAAAAGTAAACAGG - Intergenic
941561724 2:167054691-167054713 AAAAAAAAGGAAAAGGAAACAGG + Intronic
942071923 2:172324008-172324030 AAGAGCAAGGAAACACAATCCGG - Intergenic
942158580 2:173157939-173157961 ACGAACAAGGAAAAATTAACTGG - Intronic
942210152 2:173662025-173662047 AATAACAAGAAAATGTTATCTGG + Intergenic
942395964 2:175549911-175549933 AAGAAAAACCAAAAGTAAACAGG - Intergenic
942608194 2:177713967-177713989 AAGAAAAAAGAAAAGAAATATGG - Intronic
943943395 2:194028105-194028127 AGGAACAAAGAAAAGTGAACAGG + Intergenic
944504488 2:200396343-200396365 AAAAACAAGGAATAGTAAAAAGG + Intronic
944999564 2:205333821-205333843 AATAACAAGGAAAAAAAAACAGG - Intronic
945395827 2:209315973-209315995 AAAAACAAGAAAAAGAAATTAGG + Intergenic
945519647 2:210809201-210809223 CAGAACAATAAAAAGTATTCAGG - Intergenic
945555908 2:211275655-211275677 AAAAACAAGCAAAACTCATCAGG + Intergenic
945586251 2:211667336-211667358 ATAAAGAAGAAAAAGTAATCAGG + Intronic
945642685 2:212449119-212449141 AAGCACTAGTAAAAGAAATCTGG - Intronic
947452857 2:230224399-230224421 AACAAGAAGGAAAAGTATGCTGG - Intronic
947467729 2:230368631-230368653 AAAAAGAATGAAAAGTAATAAGG - Intronic
947574350 2:231260848-231260870 AATAACCAGGAAAAGTGAACAGG + Intronic
947681587 2:232038509-232038531 AAGAGCAAGGCCAAGTAACCTGG + Intronic
947698544 2:232213373-232213395 AAGGACATGGAAAAGGAGTCAGG + Intronic
947893079 2:233643581-233643603 AAGCACAAGGAAAGGTAAAGGGG - Intronic
947970923 2:234323842-234323864 AAGAAAAAGAAAAAGAAAACTGG - Intergenic
948093509 2:235315239-235315261 AAAAATAAGCAAAATTAATCAGG + Intergenic
948185241 2:236016037-236016059 AAAAAAAAGAAAAAGAAATCTGG + Intronic
948283267 2:236764951-236764973 ATGAACAGGGAAAAGGAAACTGG - Intergenic
948441940 2:237997808-237997830 AAAAACATGGAAATGTAATTTGG + Intronic
948543647 2:238709196-238709218 GAAAACAATGAAAAGTAACCAGG - Intergenic
949037632 2:241824519-241824541 AAGAAGAAGAAGAAGTAGTCAGG - Intergenic
1169496045 20:6116426-6116448 AAGAAAAAGAAAAAATAATAGGG + Intronic
1169617968 20:7471367-7471389 AAGAAGAAGGAAAAATAAAGGGG - Intergenic
1169677651 20:8172704-8172726 AAGAACAAAGAAAAATGTTCAGG - Intronic
1169788317 20:9384480-9384502 AAAAACAGGAAATAGTAATCAGG + Intronic
1169860719 20:10148738-10148760 GAGATCAAGGACAAGAAATCTGG + Intergenic
1170045531 20:12081239-12081261 AAGATTAAGGAGAAGTATTCTGG - Intergenic
1170658658 20:18315319-18315341 AAGAACCAAGAAAAGGACTCTGG + Exonic
1170746008 20:19099548-19099570 AAGGACTAAGAAAAGTCATCAGG - Intergenic
1171071385 20:22071667-22071689 AAGATCAAGGAAAACTAAATAGG - Intergenic
1171116128 20:22526307-22526329 AGAAACAAGGAAAAGGAATTTGG + Intergenic
1171162120 20:22936683-22936705 AATAATAAAGAAAAGTAAACAGG - Intergenic
1171785191 20:29457567-29457589 AGGAAGCAGGAAAAGTGATCTGG + Intergenic
1172291133 20:33777645-33777667 AAAAAGAAGAAAAAGAAATCAGG + Intronic
1172488670 20:35316630-35316652 AAGAAAAAGGAAATGGACTCAGG - Intronic
1172576042 20:36009529-36009551 AAGAAAAAGAAAAAGGAAACAGG + Intronic
1172581763 20:36053890-36053912 AAGAAAAAGAAAAAGAAAGCAGG - Intergenic
1173009937 20:39172822-39172844 AAAAAAAAGGAAAAATCATCTGG + Intergenic
1173013010 20:39199646-39199668 AAGGACAAAGAAAAGTGAACAGG - Intergenic
1173416333 20:42859470-42859492 CAGTAAAAGGAAAAATAATCCGG - Intronic
1173601139 20:44296314-44296336 AAGAAAAAGAAAAAGTTATTGGG - Intergenic
1173932151 20:46829727-46829749 AAGAAAAAGAAAAAGAAATGTGG + Intergenic
1174001361 20:47377196-47377218 AAAAAAAAAGAAAAGAAATCCGG + Intergenic
1174045656 20:47730815-47730837 AAGAATAAGGAAAAGCATACTGG - Intronic
1174930917 20:54813771-54813793 AAGAAAAAGGAAAACTAGCCAGG - Intergenic
1175049337 20:56139649-56139671 AAGAACAAGATAAAGGAATTGGG + Intergenic
1175532303 20:59682361-59682383 AAAAAAAAGGGAAAGAAATCTGG + Intronic
1176282352 20:64321073-64321095 AAGAAAAAGAAAAAGAAACCAGG - Intergenic
1176894539 21:14361141-14361163 AAGAGGAAGGAAAAGTAAATTGG + Intergenic
1177115847 21:17085573-17085595 AAAAACAAAGAATGGTAATCTGG + Intergenic
1177161534 21:17553484-17553506 AGGAACCAGGAAAAGGAATATGG + Intronic
1177538420 21:22460080-22460102 AGGAAAAAGGAAAAGGAAGCAGG + Intergenic
1177866162 21:26515337-26515359 AAGAAAAAGAAAAAGAGATCAGG - Intronic
1178386852 21:32159045-32159067 TAAAACAAGGTAAAGAAATCAGG - Intergenic
1178846056 21:36175096-36175118 AAGAAGAAGAAGAAGAAATCTGG - Intronic
1179395923 21:41039952-41039974 AAGCAGAAGGAAAAGTAAAGAGG + Intergenic
1179425851 21:41277643-41277665 AATAAGCAGGAAAACTAATCAGG - Intronic
1180571555 22:16726935-16726957 AAGAAAAAGAAAAAGAAAACAGG + Intergenic
1183127018 22:35792363-35792385 AAGAAAAAGAAAAAGAAATTAGG + Intronic
1183848269 22:40561717-40561739 AAGCACATGGAAGAGTAATGTGG + Intronic
1184169073 22:42748462-42748484 AAAAAAAAAAAAAAGTAATCAGG - Intergenic
949502150 3:4690790-4690812 AAGAACAGGCAAAACTAATCTGG + Intronic
949633076 3:5950673-5950695 AAGAAAAAAAAAAAGTAATATGG - Intergenic
949714056 3:6907652-6907674 AAGAAGAATGAAAAGAAATAAGG + Intronic
949744840 3:7277788-7277810 AAGACAAAGGAAAAATAAACAGG + Intronic
949821145 3:8116544-8116566 AAAAACAAGAAAAAGAAAACAGG - Intergenic
949953645 3:9249796-9249818 AGGCAGCAGGAAAAGTAATCGGG + Intronic
951541279 3:23784212-23784234 AAAAACAAGGAAAAGTTAACCGG - Intergenic
951819363 3:26791157-26791179 AAGAATAGGGAAAAGTAAAGGGG - Intergenic
951823461 3:26840571-26840593 AAGAATAAGGTAATGTATTCAGG - Intergenic
951929748 3:27952052-27952074 AAGCAGAGGGAAAAGTAAACGGG - Intergenic
951959321 3:28298265-28298287 AAGAATTAAGCAAAGTAATCTGG - Intronic
952000882 3:28784646-28784668 AAGAAAAAGAAAAAGAAATAGGG + Intergenic
952172551 3:30824438-30824460 AAGAGGAAGGAAAATTATTCCGG + Intronic
952454649 3:33461738-33461760 AAGAAAAAAGAAAAATAAGCTGG - Intergenic
953104382 3:39861394-39861416 AAGAACCAGCAAAAGAACTCTGG + Intronic
954218642 3:49138723-49138745 AAAAAAAAGGAAAAGAAATAGGG - Intergenic
954805119 3:53214410-53214432 AAGAAAAAGAAAAAGTAAAGGGG + Intergenic
955261322 3:57393664-57393686 AAGAAAAAGAAAAAGAAATGAGG + Intronic
955275190 3:57540495-57540517 AAGAACAAGGATAAGTATTCAGG + Intronic
955386409 3:58484643-58484665 CAGAACCAGGGAAAGGAATCTGG - Intergenic
955942353 3:64158476-64158498 AAAACCAAGGAAAAGTAACACGG + Intronic
956627493 3:71281066-71281088 AAGAAGAAGAAAAAGTAGCCAGG + Intronic
956766745 3:72490763-72490785 AAAAACAGGCAAAATTAATCTGG + Intergenic
957057019 3:75451000-75451022 AAAAAGAAGGAAAGTTAATCAGG - Intergenic
957106637 3:75897532-75897554 AAGAAAAAGAAAAAGAAAACAGG - Intergenic
957280104 3:78139806-78139828 AAGAAAAAGGAAAAGAAAAGTGG + Intergenic
957347827 3:78984644-78984666 AAGAACAAGGAAAACCTTTCTGG - Intronic
957672534 3:83324127-83324149 AAGAAGAAGGAAGAGTAAAGAGG - Intergenic
958720495 3:97837452-97837474 GAGAACAGGGAAAAAGAATCAGG - Intronic
958736993 3:98020844-98020866 AAGAAAAAGAAAAAGAAATGAGG - Intronic
958839980 3:99191868-99191890 AAGCAGAAGGAAAAGTAAAGTGG + Intergenic
958993932 3:100879515-100879537 TACAACAAGGAAAATTAAACTGG - Intronic
959069788 3:101691470-101691492 AAGAAAAAAGAAAAAGAATCAGG + Intergenic
959191340 3:103115180-103115202 AAAAACAAGGAGAAGAATTCAGG + Intergenic
959248367 3:103904963-103904985 CAGAAAAAGGAAAAGTAAGAAGG + Intergenic
959324793 3:104922983-104923005 AAAAACCAGGAAATGTATTCAGG - Intergenic
960189165 3:114682741-114682763 AAGAATTAGAGAAAGTAATCCGG - Intronic
960268061 3:115644000-115644022 CAGATTAAGGAAAAGCAATCAGG - Intronic
960421331 3:117449188-117449210 AAAAACAATGAAAAATAATCTGG + Intergenic
960485741 3:118250730-118250752 AGGAAGAAGGAAAAAAAATCTGG + Intergenic
960583418 3:119299536-119299558 AAGAACAAGGATAAGGCAACGGG + Intronic
960798354 3:121512506-121512528 AAGAAAAAGGAAAAGGTATCTGG - Intronic
961150923 3:124637146-124637168 AAGAATAAGGAACAGTGATCAGG - Intronic
961211679 3:125130610-125130632 AAGAAAAAGAAAAAGAAATACGG + Intronic
961217868 3:125175525-125175547 AAGAAGAAGGAAAATACATCAGG + Intronic
961237214 3:125377167-125377189 AAAAAAAAGGAAAAGTAAGTAGG - Intergenic
962000051 3:131286351-131286373 ATGAACAAGAAAGAGTAAACAGG - Intronic
962935713 3:140078682-140078704 AAGAACAAAGAAAAGGAAAACGG + Intronic
963068638 3:141283589-141283611 AAAAACAAAGAAAAGTACACTGG + Intronic
963330543 3:143910244-143910266 AAGCAGAAGGAAAAGTAAAGGGG + Intergenic
963569780 3:146978890-146978912 AAGAAAAAGGAAAAGCTAGCTGG - Intergenic
963594141 3:147303907-147303929 AAGAAGAAGAACAAGAAATCAGG + Intergenic
964190047 3:153991171-153991193 AAAAACAAAGATAAGTAGTCGGG + Intergenic
964206758 3:154183486-154183508 AAGCAAAAGTAAAAGTATTCTGG - Intronic
964299456 3:155271657-155271679 AGGAACAAGGAAAACAATTCTGG + Intergenic
964384914 3:156137277-156137299 AGGGATAAGGAAAAGGAATCAGG + Intronic
965014429 3:163139130-163139152 AAGAAGAAAGAAAAGTAGTAAGG - Intergenic
965018929 3:163200452-163200474 AAGAAGAAGGAAAAAAAATAAGG - Intergenic
965026164 3:163304110-163304132 AAGCAGAAGGAAAAGTAAAAGGG + Intergenic
965660961 3:171041694-171041716 AAGAAAAAAGAAAAGAAATAAGG - Intergenic
965715627 3:171599479-171599501 AAAGACAAGAAAAAGTATTCTGG - Intergenic
965724459 3:171699366-171699388 AAGCAAAAGGAAAACTCATCTGG - Intronic
966311507 3:178599416-178599438 AGGAAAAAGAAAAAGTCATCAGG + Intronic
966507482 3:180723016-180723038 GAGAACAGGGAAAAGGAATTAGG - Intronic
966647829 3:182266803-182266825 AAGAAATAGGAAAAAAAATCTGG - Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967140817 3:186557898-186557920 AAGAACAAGTAAAAATATTTTGG + Intronic
967162728 3:186753442-186753464 AAGAACAAGAAAAAGAAAGGAGG - Intergenic
967198057 3:187046539-187046561 AAGAACAGGGAAAAGTCAGAAGG + Intronic
967286057 3:187871667-187871689 ATGATGTAGGAAAAGTAATCTGG - Intergenic
968061922 3:195732316-195732338 AAGAAAAAGAAAAAGAAAACTGG - Intronic
968330448 3:197864686-197864708 AAGAAGAAGAAAAAGAAATGAGG - Intronic
968807363 4:2784067-2784089 AAGAACCAGGAAAACAATTCTGG - Intergenic
969552743 4:7881791-7881813 AAGAAAAAGTAAAAGAAACCTGG + Intronic
969727482 4:8930395-8930417 AGGAACCAGGAAAAGGAACCAGG + Intergenic
969948445 4:10808441-10808463 AAAAAGAAGGAAAAGAAATAAGG + Intergenic
970305916 4:14732590-14732612 ATGAAGAAGGAACAGTGATCAGG - Intergenic
970441864 4:16086855-16086877 AAGCAGAAGGAAAAGTAAAGAGG + Intergenic
970656755 4:18239485-18239507 AAAAACAACTAAAAGTAACCTGG - Intergenic
971584256 4:28384875-28384897 AAGAACTAGGAAATGTAGCCAGG - Intronic
971788782 4:31140434-31140456 AAGGACATGGGAAAATAATCAGG - Intronic
972145129 4:36014444-36014466 CAAAACAAGGAAAAGAAATTGGG + Intronic
972186751 4:36537841-36537863 AAGAACAAGGAAGATTATTAAGG - Intergenic
972463529 4:39329574-39329596 AAGAAAAAGAAAAATTAAGCTGG + Intronic
972747152 4:41946674-41946696 AAGAAAAGGGTAATGTAATCTGG + Intronic
972877829 4:43386514-43386536 AAGAAAAAAGAAAACTAATCAGG + Intergenic
973016758 4:45149598-45149620 ATGAAAAAGGAAAAGAAATGGGG - Intergenic
973327438 4:48877829-48877851 AAGCAGAAGGAAAAGTAATGGGG - Intergenic
973919805 4:55673548-55673570 AAGAAGAAGGAAGAGTAAAGAGG - Intergenic
974336289 4:60549652-60549674 AAGAACAAGGAAACAAAGTCAGG - Intergenic
974550276 4:63363215-63363237 AATAAAAAGGAAAAGTGATATGG - Intergenic
974810856 4:66944155-66944177 CAAAACAAGGCAATGTAATCTGG + Intergenic
974891036 4:67882773-67882795 AAGAACATAGAACATTAATCAGG - Intronic
975464558 4:74694579-74694601 AAGAACCAGGAGAATTAATGTGG - Intergenic
975697805 4:77030957-77030979 AAGGATAAGAAAAAGTAAGCAGG + Exonic
975818409 4:78243770-78243792 TAAAACAAAGAAAACTAATCTGG + Intronic
976254202 4:83083522-83083544 AAGCAGAAGGAAAAGTAAAGAGG - Intergenic
976892728 4:90069778-90069800 AAGAACAAGGAATAGAAATAAGG + Intergenic
977124291 4:93144987-93145009 ATGATCAAGGAACAGAAATCAGG - Intronic
977527831 4:98166116-98166138 AAGCAGAAGGAAAAGTAAAGTGG - Intergenic
977663659 4:99620018-99620040 AACAACAACAAAAAGTAATTTGG + Intronic
977905266 4:102470211-102470233 AAAAACAAGGAAGAGAAATGTGG - Intergenic
978430141 4:108625024-108625046 AAGAACCAAGCAAAGCAATCAGG - Intronic
978769127 4:112435416-112435438 AAGAAAAAGGAGTAGAAATCTGG - Intronic
979047575 4:115887372-115887394 AAGAAAAAGAAAAAGAAATATGG + Intergenic
979285601 4:118920876-118920898 AGGAAAAAAGAAAAGAAATCAGG - Intronic
979396736 4:120197992-120198014 AAGCAGAAGGAAAAGTAAAGGGG + Intergenic
979521721 4:121675064-121675086 AGGGAGAAGGAGAAGTAATCAGG - Intronic
979527669 4:121734566-121734588 AAGAAAACTGAAAAGTATTCAGG + Intergenic
979906716 4:126302351-126302373 AAGATATAGGAAAAGTATTCAGG - Intergenic
980187434 4:129479793-129479815 AAAAACAAGGAAAAGAAAGTAGG - Intergenic
980460859 4:133110508-133110530 AGCAATCAGGAAAAGTAATCAGG + Intergenic
980478351 4:133350622-133350644 GTGAACCAGCAAAAGTAATCTGG - Intergenic
980566845 4:134553332-134553354 AAAAACAAGGAAAGATAATTGGG + Intergenic
980576283 4:134687247-134687269 AAGAACAAGCACAAGAACTCTGG - Intergenic
980578048 4:134711201-134711223 AAGAACTAGGAAAAGAAGGCAGG + Intergenic
980597997 4:134980875-134980897 GAGAAAAAGAAGAAGTAATCAGG - Intergenic
982416748 4:155142490-155142512 AAGAGCAAGGAAAAATAAAAGGG - Intergenic
982539214 4:156646356-156646378 AGGAAAAAGGAAAAGAAATATGG + Intergenic
982680650 4:158424917-158424939 AATAACAAGGACAAGTAGTATGG + Intronic
983029811 4:162785595-162785617 AAGAAGAAGAAGAAGTAGTCAGG + Intergenic
983337873 4:166419920-166419942 AAAAAAAAGGAAAAGAAAACAGG - Intergenic
983508178 4:168578000-168578022 AAGAACATTGAAAAGTAGTATGG - Intronic
983829819 4:172312606-172312628 AAAATCAAGGAAAAAAAATCAGG + Intronic
984068506 4:175081769-175081791 AAGCAGAAGGAAAAGTAAAGTGG - Intergenic
984124791 4:175794720-175794742 AAGAAGATGGAAAATAAATCAGG + Intronic
985519554 5:367107-367129 AGGAACAAGGAAAACTAAAATGG + Intronic
986155793 5:5175034-5175056 AAGTAGGAGGAAAAGTAATGGGG - Intronic
986453428 5:7890236-7890258 AAGAAAAAGGAGGAGAAATCAGG - Intronic
986805335 5:11303607-11303629 ATGAAGAAGGAATAGTGATCAGG - Intronic
986930846 5:12818906-12818928 AAGAAAAAAAAAAAGTAAGCTGG - Intergenic
986936295 5:12891481-12891503 GAGAACAATGAAAAGTGATGAGG - Intergenic
987719989 5:21620951-21620973 TAAAACAAGGTAAAGAAATCAGG + Intergenic
988076672 5:26363024-26363046 AAGAGCAAGGAAAAGCAACATGG - Intergenic
988243496 5:28645602-28645624 ATGAAGAAAGAAAAATAATCTGG + Intergenic
988308333 5:29524461-29524483 AAGAAGTAGGAAAACAAATCTGG - Intergenic
988573621 5:32397309-32397331 ATGATGAAGGAAAAGTAATTCGG - Exonic
988914656 5:35880402-35880424 AAGAACAAGAAAAAGTAGGAAGG - Intergenic
989232948 5:39107095-39107117 AAGAAAAAGGAAAATCATTCAGG - Intronic
989510038 5:42275753-42275775 AAGAACTGGGAAAAATATTCTGG - Intergenic
990120977 5:52450996-52451018 AAGTGAAAGGAAAAATAATCAGG + Intergenic
991355375 5:65764093-65764115 AACAACAAAGAAATGTAATTTGG - Intronic
991375956 5:65967107-65967129 AAGAAAAAGAAAAAATATTCTGG + Intronic
991650250 5:68845273-68845295 ATCAACAAGGACAAGTAAGCAGG + Intergenic
992269252 5:75049494-75049516 AAGAGAAAAGAAAATTAATCAGG - Intergenic
992568182 5:78023465-78023487 AAGAAAAAAGAAAGGGAATCAGG + Intronic
992670613 5:79056859-79056881 AAGAACAGAAAAAAGTAATGGGG + Intronic
992998780 5:82358712-82358734 AACCACAAGGAAAAATAATCAGG - Intronic
993191051 5:84681944-84681966 GAGAACAAGGATCAGTAATGTGG - Intergenic
993561853 5:89419448-89419470 AAGAACCAGAAAAAATAATTGGG - Intergenic
994103825 5:95923290-95923312 AAGAACAAGGAAAAATGGTAGGG - Intronic
994163169 5:96579651-96579673 AAGAACAAGGAAAACTGGTGTGG - Intronic
994318273 5:98360023-98360045 AAGAACCAGGGCAAGAAATCTGG - Intergenic
994320213 5:98386534-98386556 AAGAAGAAGGAAGAGTAAAAAGG - Intergenic
994390512 5:99187033-99187055 AAGAAAAAGGAAAAGAAAACTGG - Intergenic
994641598 5:102417159-102417181 AACAACAAGCAAAAGAAAGCTGG - Intronic
994679264 5:102865557-102865579 AAGAAGTAGGAAAAGAAAACAGG + Intronic
994695019 5:103063109-103063131 AAGAAAAAGGAAAAATCATTAGG - Intergenic
994803893 5:104418046-104418068 AAGAACAAGTAAAGATAATGTGG + Intergenic
995500368 5:112798732-112798754 AAGAATAAAAAAAAGTAATTAGG + Intronic
995783074 5:115798315-115798337 AAGTCCAAGGGTAAGTAATCAGG - Intergenic
995991856 5:118248714-118248736 AGAAAAAAGGAAAAGAAATCAGG + Intergenic
996060733 5:119030323-119030345 AAGAAAAAAGAAAAGAAATAAGG + Intergenic
996192551 5:120563787-120563809 AAGCAGAAGGAAAAGTAAAGGGG - Intronic
996249901 5:121316981-121317003 AAGAACAAGTACAAGAACTCTGG - Intergenic
996408646 5:123131018-123131040 AAGAATAAAGAAATGTAAGCAGG - Intronic
996655992 5:125937185-125937207 AAGACCAAGGACAAGAAAACAGG - Intergenic
996659803 5:125988567-125988589 AAGAAGAAGGAAGAGTAAAGAGG - Intergenic
997548984 5:134735939-134735961 AAAAACAAAGAAAAGAGATCGGG - Intergenic
997724227 5:136106754-136106776 AAAAAAAAGGAAAAGAAACCAGG + Intergenic
998051808 5:139042183-139042205 AAGGACAAGGACAAGGATTCCGG + Intronic
998179679 5:139927773-139927795 AAAAAAAAAAAAAAGTAATCTGG + Intronic
998271426 5:140710086-140710108 AAGAAAAAGGAAAAAAAATTTGG + Intergenic
998805175 5:145911676-145911698 AGGAAATGGGAAAAGTAATCTGG - Intergenic
998986053 5:147758390-147758412 TAGAACAAAGAAAAATAATTTGG + Intronic
999760209 5:154694115-154694137 AAAAACAAAAAAAAGTAATGGGG + Intergenic
1000477752 5:161732478-161732500 AAGAGTAGGGAAAAGTAAACAGG - Intergenic
1001113129 5:168914914-168914936 AAAATCAAGAAAAAGAAATCTGG - Intronic
1001336503 5:170801837-170801859 TACAACAATGAAAAGTAATGGGG + Intronic
1001477636 5:172061962-172061984 AAGAAAAAAGAAAAGTAACATGG - Intronic
1001709821 5:173769374-173769396 TAGAATGAGGCAAAGTAATCTGG - Intergenic
1001735337 5:173993651-173993673 AAGAAAAAAGAAAAGTGATAGGG + Intronic
1001869909 5:175143502-175143524 CAGAACAAGGAAAACTATTAGGG + Intergenic
1002487138 5:179546940-179546962 AAGAAAAAGGAAAAGAAATTAGG - Intergenic
1002950029 6:1800595-1800617 AAGAAAAAGAAAAATTAATTGGG - Intronic
1003295026 6:4818682-4818704 CTGAAGAAGGAAAATTAATCTGG - Intronic
1003437955 6:6111430-6111452 AAGAAGAGGGAAAAGTAAAGGGG - Intergenic
1003846932 6:10183390-10183412 AAGAACAAGGAAAAGTAATCAGG + Intronic
1003957054 6:11173846-11173868 AAGAAAAAGGAAAAGAAAGAAGG - Intergenic
1004727018 6:18320737-18320759 AAGCAAAAAGAACAGTAATCAGG - Intergenic
1004839357 6:19565177-19565199 GAGAAGAAGGAAAAGTTCTCTGG + Intergenic
1005277165 6:24231392-24231414 ATGAAGAAGGAAAAGGTATCAGG + Intronic
1005322998 6:24674001-24674023 TACAACAAGGTAAAGGAATCAGG - Intronic
1005434440 6:25793189-25793211 AATAACCAAGGAAAGTAATCTGG - Intronic
1006195455 6:32238594-32238616 AAAAAAAAGGAAAAGAAATATGG - Intergenic
1006231741 6:32594175-32594197 AAAAAAAAAGAAAAATAATCTGG - Intergenic
1006781623 6:36636358-36636380 GAGAAGAAGGAAAAGAGATCTGG + Intergenic
1006809041 6:36808078-36808100 AAGAAAAAAGAAAAGAAATCTGG - Intronic
1007732554 6:43956439-43956461 AAGAACAAGGAAAAATGAACAGG + Intergenic
1008109119 6:47473554-47473576 AAGGACAAGGAAGGGTAGTCAGG - Intergenic
1008120812 6:47615093-47615115 AAGAAATAGGGTAAGTAATCAGG - Intronic
1008190191 6:48446844-48446866 AAGAAAAAAGAAAATTAGTCGGG - Intergenic
1008191657 6:48465866-48465888 AAGAACCAGGAAACATAATGAGG - Intergenic
1008617150 6:53237446-53237468 AACAACAAGAAACAGTAAACAGG - Intergenic
1008940455 6:57040584-57040606 AAGAAGAGGGAAAAGTAAAGAGG + Intergenic
1008970496 6:57361839-57361861 CAGAACAAGGTAAAATAATCTGG + Intronic
1009158710 6:60255335-60255357 AAATAAAAAGAAAAGTAATCAGG - Intergenic
1009159465 6:60263660-60263682 CAGAACAAGGTAAAATAATCTGG + Intergenic
1009700059 6:67165243-67165265 AAGAAAAAGAAAAAGAAATCAGG + Intergenic
1009771070 6:68143681-68143703 AAGAAGAAGAAAAAGAAATTGGG - Intergenic
1009861279 6:69336501-69336523 AAGAAAAAGGAAAAATAACATGG + Intronic
1010749639 6:79603791-79603813 AAGAAAAAAGAAAAGTGGTCTGG - Intergenic
1010864685 6:80960314-80960336 AAGAAAAAGGCAATGAAATCTGG - Intergenic
1010896370 6:81369681-81369703 AAAAACAAGTAGAAGTAATTTGG - Intergenic
1011657416 6:89564393-89564415 AACAAAAAGGAAAATTAATGTGG + Intronic
1011940501 6:92836678-92836700 AAGGACTAAGAAAAGTACTCAGG - Intergenic
1012214456 6:96564783-96564805 AAGAACAAGGAAATGCAAGCTGG - Intronic
1012333916 6:98030049-98030071 AAGAACAAGGATAAATAATTTGG - Intergenic
1012657051 6:101837560-101837582 AAGAAAAAGGGAAAATAGTCTGG + Intronic
1012815863 6:104021214-104021236 AAGAATAAGCACAAGTAAACAGG - Intergenic
1012874534 6:104710989-104711011 AAGAACAATGAAAGGTATTTTGG - Intergenic
1013093406 6:106921605-106921627 AAGAAGAAGGAAAAGGAAAAGGG + Intergenic
1013185309 6:107752530-107752552 AGGAGCAAGCAAAAGAAATCAGG + Intronic
1013693338 6:112670898-112670920 AGGAACAATGTAAAGTAATTTGG - Intergenic
1013830873 6:114271284-114271306 AAGAAGAAAGAAAAGAAACCAGG - Intronic
1013999674 6:116350192-116350214 AAGAAAACTGAAAAGTGATCAGG + Intronic
1014129543 6:117815094-117815116 AAAAACAACCAAAATTAATCAGG + Intergenic
1014494349 6:122102147-122102169 AAGAAAAAGGAAAAGAAAAGTGG + Intergenic
1014568022 6:122975084-122975106 AAGAGAAAGTAAAAGTAATCTGG - Intergenic
1014692389 6:124577818-124577840 GAGGACAAGGAAAAGTAAAGAGG + Intronic
1014918818 6:127187949-127187971 AAGAACAGTTAAAAGTGATCAGG - Intronic
1015107700 6:129556193-129556215 AAAGAGAGGGAAAAGTAATCTGG - Intergenic
1015169899 6:130240805-130240827 AAGAACAAGGAACTGGCATCCGG - Intronic
1015951378 6:138556860-138556882 AAGAACATGAAATAGAAATCTGG + Intronic
1016607293 6:145944898-145944920 AAAAACAAGAAAAATTAACCAGG + Intronic
1016958981 6:149653547-149653569 GAGAACAAGGAAAAGAAGGCTGG + Intergenic
1017368934 6:153681629-153681651 AAGAACCAGTAAAAGAACTCTGG + Intergenic
1017420745 6:154269787-154269809 AAGAATTAGGAAAAGAAATGAGG + Intronic
1017517886 6:155174057-155174079 TAGAATAATGGAAAGTAATCAGG + Intronic
1018181773 6:161229535-161229557 TAGAGCAAGGAAAAGGAACCAGG + Intronic
1018329430 6:162711431-162711453 AAAAACCAGGAAAAGTCATGTGG + Intronic
1019697281 7:2452634-2452656 AAGAAGAAGGAAAAGAAAGAAGG - Intergenic
1019951085 7:4373292-4373314 AAGAAGAAGAAAGAGTAGTCAGG - Intergenic
1020047717 7:5055075-5055097 AAGAAAAAGTAAAAGTGCTCGGG - Intronic
1020941872 7:14549654-14549676 AAAAACACAGAAAAGTTATCTGG + Intronic
1021138033 7:16990088-16990110 AAGAACCAGGGAAAGAAGTCTGG - Intergenic
1021640980 7:22735811-22735833 AAGCAGAGGGAAAAGTAAACGGG + Intergenic
1021791611 7:24211647-24211669 ACTAACAAGAAAAAGGAATCAGG - Intergenic
1021885107 7:25130267-25130289 AAGAAAAAAGAAAAGCAAGCTGG + Intergenic
1022043595 7:26604037-26604059 AAGAGCAAGGAGCAGGAATCTGG + Intergenic
1022224938 7:28353463-28353485 AAGAACAAGGAAGACTAGCCGGG + Intronic
1022436417 7:30390124-30390146 TAGAACAAGGTAAAGGAAACAGG - Intronic
1022684927 7:32587851-32587873 AAGGACAAAGAAAAGGAATGTGG + Exonic
1023166529 7:37348852-37348874 AAAAACAACAAAAAGTGATCAGG - Intronic
1023521936 7:41058137-41058159 AAGAACAAGAAAAAATCATCAGG - Intergenic
1023789378 7:43740544-43740566 AAGAAAAAGAAAAAGAAATAGGG - Intergenic
1024489877 7:49968163-49968185 AAGAACTAAAAAAAGAAATCAGG + Intronic
1025794726 7:64729055-64729077 AAGAACCAGAAAAAAAAATCTGG - Intergenic
1026202797 7:68229771-68229793 AAAAACAATGAAAACTAAACAGG + Intergenic
1026686262 7:72512789-72512811 AAAAACAAGTAAAATTAAGCAGG - Intergenic
1026710163 7:72730811-72730833 AAAGACATGGAAAAGTAAACAGG + Intronic
1027195457 7:76027077-76027099 AAGAATAAAGAAAAGAAACCAGG + Intronic
1027629507 7:80585052-80585074 AGGAACAAGGCAAAGTAAAGGGG + Intronic
1028288257 7:89031580-89031602 CAGAACAAGGAAAAAAAATTAGG - Intronic
1028368833 7:90067792-90067814 AAAAAAAAGGAAATGTACTCTGG + Intergenic
1028446045 7:90925563-90925585 AAGAACAATGTAAAATAAACTGG + Intronic
1028519071 7:91708677-91708699 AAAAACAATGCAAAGAAATCAGG + Intronic
1029390108 7:100269411-100269433 AAAAAAAAAGAAAAGTAAACAGG + Intronic
1029465546 7:100722459-100722481 AAGAAAAAAGAAAAATAATGAGG + Intronic
1030082504 7:105789748-105789770 AAGAACAATGAGAAGTACTGGGG + Intronic
1030645670 7:112058741-112058763 AAGAAAAAGGAAAAAGAATCTGG + Intronic
1030910416 7:115241467-115241489 ATGAGGAAGGAAAATTAATCAGG - Intergenic
1030925917 7:115454400-115454422 AAGAACAAGGAAAGGGAGCCAGG + Intergenic
1031158699 7:118140786-118140808 AAGAACAAGGACAAAATATCAGG - Intergenic
1031288106 7:119898352-119898374 AAGAACAAACAAAAGAACTCTGG + Intergenic
1031526340 7:122825566-122825588 AAGAACAAGGTAAAGGAAACAGG + Intronic
1031683783 7:124708166-124708188 AAAAACAATGCAAAGAAATCAGG - Intergenic
1032069515 7:128795139-128795161 AGGAACCAGAAAAAGGAATCCGG - Intronic
1032695306 7:134330778-134330800 AAGAACAAGCAAAAGTGAATGGG - Intergenic
1033005138 7:137552919-137552941 AAAAAAAAGGAAAAGAAAGCTGG + Intronic
1033187857 7:139245817-139245839 AAGCACAAGGAACAGTAAGAAGG + Intronic
1033302087 7:140195556-140195578 AAGAAAAAGAAAAATTAGTCTGG - Intergenic
1033649457 7:143329760-143329782 AAAAACGAGGAAAAGGAACCAGG - Intronic
1034123618 7:148651210-148651232 AAGAAAAAGAAAAAGGAACCAGG + Intergenic
1034130114 7:148707998-148708020 AAGAAAAAAGAAAGGTAACCTGG - Intronic
1034135189 7:148761513-148761535 AAGAAAAAGAAAAAGAAATATGG + Intronic
1034888838 7:154821263-154821285 AAGAAAAAAGAAAAGACATCAGG - Intronic
1034906192 7:154949150-154949172 GAAAACAAGGAAAAGTGATTTGG + Intronic
1035076015 7:156178064-156178086 AAGAAAAGAGAAAAGTATTCGGG + Intergenic
1037214526 8:16432331-16432353 AAGAAAAAGAAAAAAGAATCTGG + Intronic
1037476600 8:19263767-19263789 AATAAAAGGGGAAAGTAATCAGG - Intergenic
1037721492 8:21448204-21448226 AAGAAAAAGAAAAAGAAATAAGG + Intergenic
1038237635 8:25776117-25776139 AAAAACAGGGAAAAGTTGTCCGG - Intergenic
1039157818 8:34581589-34581611 AAGAAAAAGGAAAAGAAAGAAGG + Intergenic
1039492575 8:37958995-37959017 AAGAAAAAGAAAAAGAAATGGGG + Intergenic
1039535772 8:38311068-38311090 AAAAAAAAAAAAAAGTAATCAGG - Intronic
1039744831 8:40415241-40415263 AAAAAAAAGGAAAAGAAATCTGG + Intergenic
1040051494 8:43019422-43019444 AAGAACAAGTAAAACAAATGGGG - Exonic
1040429852 8:47328784-47328806 TAGAAAAAGAAAAAGTAAACTGG - Intronic
1040919719 8:52602687-52602709 AAGAAAAAGAAAAAGAAAACAGG + Intergenic
1041145346 8:54870246-54870268 AAGAAAAAGGAAAAGAAAGAAGG - Intergenic
1041363719 8:57079088-57079110 AAGCCCAAGGAAAAGAACTCAGG - Intergenic
1042311061 8:67379859-67379881 AAGAACAAGGAGAAGGAAGAAGG - Intergenic
1042315932 8:67425874-67425896 AAGAAAAAGAAAAAGAAATGAGG - Intronic
1042575078 8:70209005-70209027 AAGTACAAAGAAAAATATTCTGG + Intronic
1042576897 8:70230629-70230651 AAGAATAAGGAAAACTCATTTGG - Intronic
1043670885 8:82882726-82882748 AAAAACAATGAAAAGAAATTAGG + Intergenic
1043812951 8:84765294-84765316 AAGAACAAGGAGAGGTAGTGGGG + Intronic
1044088292 8:87969138-87969160 AAGAAAAAGAAAAAATAATTGGG - Intergenic
1044196594 8:89384392-89384414 AAGAAAAAGAAAAAGAAATCAGG - Intergenic
1044478495 8:92656560-92656582 AAGAATAAGGAAAACAAAGCTGG + Intergenic
1044830120 8:96239009-96239031 AAGAATAAGGAAAAGGAAAGTGG - Intergenic
1044920771 8:97167273-97167295 AAGAACAAGGAAATCAAATACGG + Intergenic
1045355176 8:101380633-101380655 AAGAAAAAGGAGAAGTAAAAGGG - Intergenic
1045519358 8:102889835-102889857 AAAAAAAAGGAAAAGAAATTTGG + Intronic
1046170649 8:110500910-110500932 AAGAAAAAGAAAAACTACTCAGG - Intergenic
1046523350 8:115353657-115353679 AACAACAACAAAAAGAAATCTGG - Intergenic
1046905285 8:119565915-119565937 AATTACAATGAAAAATAATCTGG - Intronic
1047875365 8:129130827-129130849 AAAAACAAGGATAAGAATTCTGG + Intergenic
1048935787 8:139355628-139355650 AAGAAAAAGGAAAAGTTAAATGG - Intergenic
1050419922 9:5452458-5452480 AAGAGCAATGAAATGTAAACTGG - Intronic
1050523943 9:6529425-6529447 AAGAAAAAAGAAAAGAAATATGG - Intergenic
1050613372 9:7376337-7376359 AGGGACAGGGAAAAGTCATCTGG + Intergenic
1050861205 9:10433186-10433208 AAGGACTAGGAAAGGTAATAAGG - Intronic
1051159313 9:14188325-14188347 AAAAACAAGGCAAAGCAATCTGG + Intronic
1051229233 9:14937046-14937068 AAGAACAAAGAATAGAAGTCAGG + Intergenic
1051454821 9:17243271-17243293 AAGAACAATGAAAAGAAACTGGG - Intronic
1051891893 9:21950755-21950777 AAGAAGAAAGAAAAGAAAACTGG + Intronic
1051932543 9:22403859-22403881 GAGAGCAAGGTAAAGTAATAAGG + Intergenic
1052126739 9:24785183-24785205 AAATAAAAGGAAAAGAAATCTGG - Intergenic
1052173476 9:25429007-25429029 AAAAAGAAGGAAAAGGAATGAGG + Intergenic
1052214639 9:25951248-25951270 AAGCAGAAGGAAAAGTAAAGAGG - Intergenic
1052595768 9:30556648-30556670 AAGAACAAGGAAAATGAGTGAGG + Intergenic
1052623888 9:30949472-30949494 CTGAACAAGGTAAAGTAATAGGG - Intergenic
1053204438 9:36174173-36174195 AAGCAGAAGGAAAAGTAAAGGGG + Intergenic
1053899054 9:42774711-42774733 ATGAACAATGAAAAGTCATATGG - Intergenic
1055117976 9:72625700-72625722 AAGAAAAAAAAAAAGGAATCAGG + Intronic
1055295191 9:74826712-74826734 AAGAAAAAGAAAAAGAAATAGGG - Intronic
1055308016 9:74951266-74951288 AAGAAAAAAGAAAATTAATTTGG - Intronic
1055339251 9:75263794-75263816 AAGCAGAAGGAAAAGTAAAAGGG - Intergenic
1055500702 9:76899933-76899955 AAGAACAATGGAAAGTGATGAGG + Intronic
1055503762 9:76927492-76927514 AAGAAACAGGAAAAGAAATTGGG - Intergenic
1057632159 9:96728370-96728392 AAGAACAAGAAAAAGGAAATGGG - Intergenic
1058383137 9:104401318-104401340 AAGAATAAGAATAAGTGATCTGG - Intergenic
1058748507 9:108015851-108015873 AAGAACAGGGCAGAGTACTCAGG - Intergenic
1059074254 9:111174929-111174951 CAAAACAAGGAAAACTAATATGG - Intergenic
1059611483 9:115902081-115902103 AATAACAAGAAAAAGTCAACTGG + Intergenic
1059620674 9:116002224-116002246 GAGATCAAGGAAAAGTAAAAGGG - Intergenic
1059978783 9:119746285-119746307 AAGAAAAAGAAAAAGAAATATGG + Intergenic
1060049108 9:120364537-120364559 GAGAAAAAGGAAAAGAAATCAGG + Intergenic
1060078032 9:120612629-120612651 AAGAAAAAGAAAAACTAATAGGG + Intronic
1060110151 9:120901187-120901209 AACAACAAAAAAAAGAAATCAGG - Intergenic
1060256179 9:122033105-122033127 AAGAAAAAGAAAAAGAAATAAGG - Intronic
1061166626 9:128926534-128926556 AAGAAAAAGAAAAAGGAAGCTGG - Intronic
1061638276 9:131929334-131929356 AAGCAGAAGGAAAAGTAAAAGGG + Intronic
1061691569 9:132336571-132336593 AAGAACACAGAAAAGAAAACAGG + Intronic
1061946425 9:133910836-133910858 AAGAAAAAGAAAAAGAAAACTGG + Intronic
1062156881 9:135054635-135054657 AAGCACAAGGAACTGCAATCAGG + Intergenic
1185481258 X:448106-448128 AAGAAAAAAGAAAATTAGTCTGG - Intergenic
1185996826 X:4960885-4960907 ATGAACAAGGAAAGGGAAACAGG + Intergenic
1186054539 X:5634974-5634996 AAAAACAAAAAAAAGTAATATGG + Intergenic
1186584593 X:10859250-10859272 GAGAACACGGATAAGTAAACTGG - Intergenic
1187339604 X:18409375-18409397 AAGAAAAAAAAAAAGTATTCAGG - Intergenic
1187341829 X:18427412-18427434 AAGTACAAGGAAACCTAATTAGG + Intronic
1187779086 X:22797155-22797177 AAGAATAAGCAGCAGTAATCTGG + Intergenic
1188564076 X:31505613-31505635 AAGTAAAAGAAAAAGAAATCAGG - Intronic
1188837783 X:34979187-34979209 AAGAACTAGCACAAGAAATCTGG + Intergenic
1188924625 X:36023990-36024012 AAGCAGAGGGAAAAGTAATGGGG - Intergenic
1188962877 X:36514537-36514559 AAGAACAAAGAAAATTGAGCTGG + Intergenic
1189172354 X:38921947-38921969 TAGCACATGGAAAAGTAACCAGG - Intergenic
1189212543 X:39296110-39296132 AAGAACATGGCACAGTCATCTGG + Intergenic
1189260534 X:39675489-39675511 AAGAAAAAGGAAAGGAATTCTGG + Intergenic
1189334188 X:40160418-40160440 AAAAAAAAGAAAAAGTAATCCGG - Intronic
1189457074 X:41201544-41201566 AAGAAAAAGAAAAAGTAAGTAGG + Intronic
1189789349 X:44588639-44588661 AAAAAAAAGGAAAAGGAATCTGG - Intergenic
1189791781 X:44611857-44611879 AAGAAAAAGAAAAAGAAATGAGG - Intergenic
1189805636 X:44732973-44732995 AAGAATAACAAAAAGTAGTCAGG - Intergenic
1190466450 X:50728890-50728912 AAGAACAAAGAAAAAAAATTGGG + Intronic
1190769887 X:53505487-53505509 AAGAAAAAGAAAAAGAAAACAGG - Intergenic
1190804493 X:53821902-53821924 AAAAAAAAGCAATAGTAATCTGG + Intergenic
1190877024 X:54467338-54467360 AAGAAAAAGAAAAAAGAATCAGG - Intronic
1190992390 X:55565982-55566004 GAGAACAAGGAAAAGCAAGGTGG + Intergenic
1191740284 X:64429746-64429768 TAAAACAAGGAAAAGGAAGCAGG + Intergenic
1192930331 X:75799744-75799766 AAGAAGAAGGAAGAGTAGTGTGG - Intergenic
1193035229 X:76942921-76942943 CAGAACAAGGAAAATTAACAAGG - Intergenic
1193088398 X:77468161-77468183 AAGCAGAAGGAAAAGTAAAGGGG + Intergenic
1193215421 X:78857819-78857841 AAGAAAAAGGGAAAGTACTAGGG - Intergenic
1193469798 X:81886860-81886882 AGGAACCAGAAAAAATAATCTGG - Intergenic
1193551631 X:82900088-82900110 AAGAACAAGCACAAGAACTCTGG + Intergenic
1193578222 X:83230558-83230580 AAGAACCAGTGCAAGTAATCTGG - Intergenic
1193677432 X:84473030-84473052 AAAAAGAAAGAAAAGTAATTCGG + Intronic
1193718131 X:84955646-84955668 TAAAACAAGGTAAAGGAATCAGG - Intergenic
1193873489 X:86831372-86831394 AAGAAGTAGGAAAAGAAATGTGG - Intronic
1194016258 X:88625093-88625115 AAGAAGAGGGAAAAGTAAAGGGG + Intergenic
1194060025 X:89184739-89184761 AAGAAGAAGGACAAGTACACTGG + Intergenic
1194235113 X:91373151-91373173 AAGAACCAGAAAAAGAAATCTGG + Intergenic
1194423732 X:93710122-93710144 AAGAAGAAGAAAAAGAAGTCTGG + Exonic
1194543520 X:95204436-95204458 AAGAATAATGAAAAGAAAGCAGG - Intergenic
1194561565 X:95428060-95428082 AAGCACAGGGAAAAGTAAAGAGG + Intergenic
1194791794 X:98159922-98159944 AAGAAGAGGGAAAAGTAAAGAGG + Intergenic
1194811833 X:98396878-98396900 AAGTACAAGTTAAAGGAATCGGG + Intergenic
1194841968 X:98754040-98754062 AAGCAGAAGGAAAAGTAAAGGGG - Intergenic
1195104971 X:101594476-101594498 AAGAACAAAGAAAAGCAAAGCGG - Intergenic
1195890498 X:109688383-109688405 AAGAGCAGGGAAAATTAATGAGG - Intronic
1196485591 X:116203396-116203418 AAAAATAAGGAAAAGTAAAGGGG - Intergenic
1196495344 X:116318022-116318044 AAGAACAAGGAGCAGTAGCCAGG + Intergenic
1196852910 X:119955736-119955758 AAGAAAAAGAAAAAGAAAGCCGG - Intergenic
1197068867 X:122268952-122268974 AAGAAAAAGTAAAAGAAATCAGG - Intergenic
1197363205 X:125532758-125532780 AAGCAGAAGGAAAAGTAAAGGGG - Intergenic
1197556260 X:127958660-127958682 AAAAACAAGAAAAAGTAGCCAGG + Intergenic
1197640397 X:128960553-128960575 AAGAGCAAAGAAGAGTAATAAGG + Intergenic
1197767869 X:130070813-130070835 AAGAAAAAGGAAAAGAAAAAAGG + Intronic
1197793855 X:130280775-130280797 GAAAACAAGGAAAAGGACTCAGG - Intergenic
1197920409 X:131587080-131587102 AAGAACTGGCAAAACTAATCTGG + Intergenic
1197987156 X:132278667-132278689 AAGCAGAGGGAAAAGTAATGGGG - Intergenic
1198110283 X:133497002-133497024 AAGAAAAAAGAAAAGAAATATGG + Intergenic
1198293025 X:135257135-135257157 AAGAACAGAGAAAAGTAAAGGGG + Intronic
1198492750 X:137159114-137159136 AAAAAAAAGGAAAAGAAAACAGG + Intergenic
1198589599 X:138162607-138162629 AAGAAAAAGGAAAAATGAACTGG + Intergenic
1198927456 X:141814884-141814906 AAGCAAAAGGAAAAGTAAAGGGG - Intergenic
1199166934 X:144687410-144687432 AAGAAGATTGAAAATTAATCAGG - Intergenic
1199374256 X:147088445-147088467 AAGCAAAAGGAAAAGTAAATGGG - Intergenic
1199658893 X:150026553-150026575 AAGAACAAAGAAAATTACTAAGG + Intergenic
1199810310 X:151342583-151342605 AAGAAGATGGAAAAGAAATGAGG + Intergenic
1199991632 X:152990562-152990584 AAGAATAAGGAGAAGCCATCAGG - Exonic
1201272824 Y:12272011-12272033 AAGAAAAAAAAAAAGAAATCTGG - Intergenic
1201678307 Y:16613223-16613245 ATGAACAAGGAAAGGGAAACAGG - Intergenic
1201705336 Y:16930315-16930337 AAGAAAAAGAAAAAGAAAGCAGG + Intergenic