ID: 1003848235

View in Genome Browser
Species Human (GRCh38)
Location 6:10196194-10196216
Sequence CCGCAGGCAGAGAGTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 526
Summary {0: 1, 1: 0, 2: 0, 3: 48, 4: 477}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003848235_1003848243 16 Left 1003848235 6:10196194-10196216 CCTTCCTCACTCTCTGCCTGCGG 0: 1
1: 0
2: 0
3: 48
4: 477
Right 1003848243 6:10196233-10196255 TCCACCTTCAGTATCCAGGGTGG 0: 1
1: 0
2: 2
3: 20
4: 207
1003848235_1003848242 13 Left 1003848235 6:10196194-10196216 CCTTCCTCACTCTCTGCCTGCGG 0: 1
1: 0
2: 0
3: 48
4: 477
Right 1003848242 6:10196230-10196252 GACTCCACCTTCAGTATCCAGGG 0: 1
1: 0
2: 1
3: 12
4: 170
1003848235_1003848241 12 Left 1003848235 6:10196194-10196216 CCTTCCTCACTCTCTGCCTGCGG 0: 1
1: 0
2: 0
3: 48
4: 477
Right 1003848241 6:10196229-10196251 TGACTCCACCTTCAGTATCCAGG 0: 1
1: 0
2: 1
3: 11
4: 176
1003848235_1003848247 29 Left 1003848235 6:10196194-10196216 CCTTCCTCACTCTCTGCCTGCGG 0: 1
1: 0
2: 0
3: 48
4: 477
Right 1003848247 6:10196246-10196268 TCCAGGGTGGACCCATGACTGGG 0: 1
1: 0
2: 0
3: 11
4: 109
1003848235_1003848246 28 Left 1003848235 6:10196194-10196216 CCTTCCTCACTCTCTGCCTGCGG 0: 1
1: 0
2: 0
3: 48
4: 477
Right 1003848246 6:10196245-10196267 ATCCAGGGTGGACCCATGACTGG 0: 1
1: 0
2: 0
3: 5
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003848235 Original CRISPR CCGCAGGCAGAGAGTGAGGA AGG (reversed) Intronic
900285836 1:1899866-1899888 CCTCAGGCTGAGAGTGTGGCTGG + Intergenic
900614382 1:3558106-3558128 CTGCAGGCAGTGAGTGCTGAGGG - Intronic
900954492 1:5878118-5878140 CTGGTGCCAGAGAGTGAGGAAGG - Intronic
901190162 1:7405124-7405146 CTGCAGGAAGTGAGGGAGGAGGG - Intronic
901264406 1:7899071-7899093 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
901440309 1:9273612-9273634 CCGCAGCCAGTGAGTGGGGACGG - Intergenic
901624447 1:10616088-10616110 CCGCAGGCAGGGAGGGAGTTTGG + Intronic
901670194 1:10851575-10851597 ACCCAGGCAGCGGGTGAGGAAGG - Intergenic
901921751 1:12541807-12541829 CCCGTGGCAGAGAGTGAGGGAGG - Intergenic
902510824 1:16966098-16966120 GCGGTGGCTGAGAGTGAGGAAGG + Exonic
903261834 1:22135817-22135839 CCTCAGGCGGAGAGAGAGAACGG + Intronic
903291992 1:22319807-22319829 CTGCAGGAAGAGAGAGAGGGAGG + Intergenic
903942472 1:26941372-26941394 CAGCAGGTAGAGAGTGGGGCTGG + Intronic
904266966 1:29323745-29323767 TGGCAGGCCGAGAGTGGGGATGG + Exonic
904379804 1:30103061-30103083 CCGCAGGCAGGGTGTGAGGCCGG + Intergenic
904426038 1:30423772-30423794 CAGAAGGCAGAGGATGAGGAAGG + Intergenic
904547445 1:31286744-31286766 GAGTAGTCAGAGAGTGAGGAAGG - Intronic
905293320 1:36938262-36938284 GACCAGGCAGAGAGAGAGGATGG + Intronic
905474096 1:38213788-38213810 CTGCAGGCAGGGAGCGAGGCTGG - Intergenic
905596721 1:39214087-39214109 CTGAAGGCAGGGAGGGAGGAGGG - Intronic
906126051 1:43427604-43427626 TCCCAGACAGAGAGTGCGGATGG + Exonic
906293110 1:44632432-44632454 CGGCAGGCAGTGAGGGAGGGAGG - Intronic
906403393 1:45521955-45521977 CCGGAGGAGGAGAGAGAGGAGGG + Intronic
906794609 1:48687196-48687218 CCGCAGGCACACAGAGAGCAAGG + Intronic
908358356 1:63344083-63344105 CTGGATGCAGAGAGGGAGGAAGG - Intergenic
909288733 1:73854915-73854937 CGGGAGGGAGAGAGGGAGGAAGG + Intergenic
910538162 1:88323620-88323642 CAGGAGGAAGAGAGTGAAGAGGG + Intergenic
911519456 1:98911036-98911058 CATCAGGCAGAAAGGGAGGAAGG - Intronic
911779518 1:101858693-101858715 CAGGAGGAAGAGAGTGAAGAGGG - Intronic
912364033 1:109118216-109118238 CAGTAGGCAGAGATGGAGGAAGG + Intronic
912556087 1:110517160-110517182 CAGAAGGAAGAGAGAGAGGAGGG + Intergenic
912577454 1:110686408-110686430 CCACATGCAGAGGTTGAGGAAGG - Intergenic
913106225 1:115616411-115616433 CCCCCGACACAGAGTGAGGAAGG - Intergenic
913601059 1:120421471-120421493 AGGCAGGGAGAGAGGGAGGAAGG - Intergenic
915121157 1:153630179-153630201 GCCCAGGCAGGGATTGAGGAGGG - Intronic
918112565 1:181469948-181469970 CTTCAGCCAGAGGGTGAGGAGGG + Intronic
918278912 1:182983633-182983655 CCGGAGGTAGAGAGTGATGATGG - Intergenic
918300040 1:183195163-183195185 GCCCAGGCAGACAATGAGGAGGG - Intronic
919579151 1:199349615-199349637 CAGCAGGAAGAGAGTGAAGTGGG - Intergenic
919809545 1:201399848-201399870 CCGAAGCCAGGGAGTGGGGAGGG - Intergenic
919816662 1:201445129-201445151 CTGCAGGCAGAAAGGGAGGTAGG + Intergenic
920037460 1:203075508-203075530 CTCCAGGCAGGGCGTGAGGATGG + Intronic
920195521 1:204223664-204223686 CCCCAGGCAGGGAGTGAGGCAGG + Intronic
922315106 1:224434837-224434859 CCACCGGAAGTGAGTGAGGAGGG - Intronic
923561959 1:235048362-235048384 CCGGAGGCCGCGGGTGAGGAAGG - Intergenic
923963495 1:239109140-239109162 CAGCAGGCAGAGAGAGAGGGAGG + Intergenic
924466609 1:244304246-244304268 CCGGAGGCAGAGAGTCTGGAGGG - Intergenic
1067191676 10:44075109-44075131 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1067414943 10:46095751-46095773 CTGCAGGCACACAGTGGGGAGGG + Intergenic
1070324309 10:75377982-75378004 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1070727621 10:78803069-78803091 CCGCAGGAAGCGCGTGGGGAGGG + Intergenic
1070739680 10:78894545-78894567 CCCCAGGCAGAGGATGTGGAAGG + Intergenic
1071305548 10:84295993-84296015 CGGCAGTCAGAAACTGAGGAAGG - Intergenic
1071366752 10:84908030-84908052 CCGCAGGAGGAGTCTGAGGAGGG - Intergenic
1072138260 10:92567472-92567494 ACGCAGGCAGAGACTGATGAGGG - Intronic
1072771237 10:98140437-98140459 CAATAGGCAGAGAGAGAGGAGGG + Intronic
1073249999 10:102115278-102115300 CCACTGGCAGAGATGGAGGAGGG + Intronic
1073398607 10:103238872-103238894 CAGAAAGGAGAGAGTGAGGATGG + Intergenic
1074862824 10:117525171-117525193 CCAGAGGCAGAGAGTGGAGAGGG + Intergenic
1074969651 10:118525630-118525652 CAGGAGGAAGAGAGAGAGGAAGG - Intergenic
1075466003 10:122650644-122650666 CAGCAGGCTGTGAATGAGGATGG - Intergenic
1075521902 10:123148279-123148301 CAGCAGGCAGGCAGTGGGGAGGG - Exonic
1075546188 10:123356621-123356643 CCGGTGACAGAGAGGGAGGATGG + Intergenic
1076120687 10:127934721-127934743 CCCCAGGCACAGAGCGGGGAAGG - Intronic
1076162301 10:128254620-128254642 CAGCAGGCAGAGAGGGAGGTTGG + Intergenic
1076214245 10:128679969-128679991 CTGGAGGCAGAGAGGAAGGAAGG + Intergenic
1076443038 10:130493254-130493276 ACTCAGGCAGCCAGTGAGGAAGG + Intergenic
1076444116 10:130500262-130500284 CTGCAGGCAGAGAGCAAGGATGG + Intergenic
1076452205 10:130564626-130564648 TCACTGGGAGAGAGTGAGGAAGG + Intergenic
1076828372 10:132981846-132981868 CTCCAGGCCGAGGGTGAGGATGG - Intergenic
1076930627 10:133529407-133529429 GGGCAGGCAGGGAGGGAGGAAGG - Intronic
1077439054 11:2559842-2559864 CCAGAGACAGAGAGGGAGGAAGG - Intronic
1078164573 11:8871089-8871111 CTGCAGGGAGAGAGAGGGGAGGG + Intronic
1078189059 11:9076335-9076357 TCACAGGCAGAGTGGGAGGAAGG - Intronic
1079205817 11:18413412-18413434 CCAAAAGCAGAGAGGGAGGAGGG - Intronic
1079372749 11:19865497-19865519 CCCCAGGAAGAGAGTGAGGCTGG - Intronic
1079964399 11:26963213-26963235 CAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1080191373 11:29553145-29553167 CCTCAGGCAGAGTCTCAGGAAGG - Intergenic
1080582723 11:33657141-33657163 AAGCAAGCAGAGAGGGAGGAAGG + Intronic
1080812189 11:35715843-35715865 CAGGAGGAAGAGAGAGAGGAAGG + Intronic
1081622185 11:44625107-44625129 CAGCAGGCAAAGAGGGAGCAGGG + Intergenic
1081691316 11:45080439-45080461 CTGTAGGCAGGGGGTGAGGATGG - Intergenic
1084094400 11:66901342-66901364 AAGCTGGTAGAGAGTGAGGAAGG - Intronic
1084225117 11:67710980-67711002 CGGCTGGCAGAGACAGAGGAGGG - Intergenic
1084262936 11:67990822-67990844 CGGCTGGCAGAGACAGAGGAGGG - Intergenic
1084321717 11:68377097-68377119 CCCCAGGCAGGCAGTGGGGATGG - Intronic
1084641704 11:70430170-70430192 CCGCCTGCAGAGGGAGAGGAGGG + Intronic
1084810457 11:71608294-71608316 CGGCTGGCAGAGACAGAGGAGGG + Intergenic
1085299538 11:75450165-75450187 CGGCAGGGAGAGACTGAGGCAGG + Intronic
1085533847 11:77206604-77206626 CCTCAGGTGGAGAGGGAGGAAGG - Intronic
1086276304 11:85133736-85133758 CTGCAGACAGCAAGTGAGGAGGG - Intronic
1087118944 11:94552876-94552898 ACGAAGGCAGAGGGTGAGAAAGG - Intronic
1087406982 11:97743000-97743022 AGGCAGGCAGGGAGAGAGGAAGG - Intergenic
1087518817 11:99203020-99203042 AGGCAGGCAGAGAGGGAGGGAGG + Intronic
1089138790 11:116270162-116270184 GGGCAGGCAAAGAGTGGGGATGG - Intergenic
1089691801 11:120191474-120191496 CCTCAAGCAGGGAGAGAGGATGG + Intergenic
1090003835 11:122983448-122983470 ACGAAGGGAGAGAGAGAGGAAGG + Intergenic
1090134793 11:124186030-124186052 CTGCAGGTAGACAGTGATGATGG - Exonic
1090845673 11:130528045-130528067 GCCCAGGGAGGGAGTGAGGAGGG + Intergenic
1091028250 11:132160863-132160885 CCGCAGGCAGTGAGAGAAGGAGG + Intronic
1091419955 12:328224-328246 TATCAGGCAGAGAGGGAGGAGGG + Intronic
1093846196 12:23973929-23973951 GCACAGGCAGGGAGTGGGGATGG - Intergenic
1094331561 12:29299766-29299788 AGGCAGGCAGAGTATGAGGAGGG - Intronic
1094452459 12:30597081-30597103 CAGCAGGCATTGAGTGAAGAAGG + Intergenic
1095285729 12:40407952-40407974 CTGCAGGCTGAGGGTGAAGAAGG - Intronic
1096050736 12:48605408-48605430 CAGAAGGAAGAGAGAGAGGAGGG + Intergenic
1096225546 12:49864645-49864667 AAGCAAGCAGAGAGTGTGGAGGG + Intergenic
1096666461 12:53169739-53169761 GCGCAGGGAGAGGCTGAGGAGGG - Intronic
1101926207 12:108973313-108973335 CCGAGGGCAGGGAGTGGGGATGG + Intronic
1102123169 12:110458978-110459000 CTGGAGGCTGAGGGTGAGGAAGG - Intronic
1102453186 12:113056541-113056563 CCCCAAGCAGAGCGTGAGGCAGG - Intergenic
1102454179 12:113061268-113061290 CCCCAACCAGAGAGGGAGGAAGG + Intronic
1102635043 12:114315986-114316008 CCACAAGAAGACAGTGAGGAGGG - Intergenic
1103030220 12:117606667-117606689 AGGCAGGCAGGGAGGGAGGAAGG - Intronic
1104766563 12:131333754-131333776 CCACAGGTGCAGAGTGAGGAGGG + Intergenic
1104812850 12:131628889-131628911 CAGCAGGTGCAGAGTGAGGAGGG - Intergenic
1106572047 13:30935475-30935497 CAGCAGCCAGAGAATGAAGAGGG + Intronic
1106776996 13:33017592-33017614 CTGCAGGAAGAGAATGAGCAGGG + Intronic
1107484679 13:40814153-40814175 CCTCAGGCAGAGGCTGAGGTAGG - Intergenic
1107727960 13:43318966-43318988 CTGGAGGGAGAGAGGGAGGAAGG + Intronic
1108848254 13:54700274-54700296 CCACAGCCAGCGAGTGAGGGGGG + Intergenic
1109024426 13:57140992-57141014 CCGCAGCCAGGGAGTCTGGAGGG - Exonic
1109025413 13:57147562-57147584 CCGCAGCCAGGGAGTCTGGAGGG - Exonic
1109026403 13:57154135-57154157 CCGCAGCCAGGGAGTCTGGAGGG - Exonic
1109027395 13:57160706-57160728 CCGCAGCCAGGGAGTCTGGAGGG - Exonic
1109028381 13:57167271-57167293 CCGCAGCCAGGGAGTCTGGAGGG - Exonic
1109467053 13:62748930-62748952 CTGCAGGCAGAGAGTAATCAAGG - Intergenic
1110080926 13:71310061-71310083 TCGAAGGCAGAGAGTGAGACTGG - Intergenic
1110379918 13:74838925-74838947 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1110657286 13:78015168-78015190 CAGCAGGCAAAGAGAGAAGAAGG + Intergenic
1110766808 13:79289211-79289233 AGGCAGGCAGAAAGTGAAGATGG + Intergenic
1113659700 13:112097249-112097271 CCTCAGTCTGAGAGTGAGCACGG - Intergenic
1114333419 14:21661413-21661435 AAGAAGGCAGGGAGTGAGGAAGG - Intergenic
1114675978 14:24440571-24440593 CAGCATGGGGAGAGTGAGGAAGG - Exonic
1115087560 14:29535627-29535649 CGGAAGGAAGGGAGTGAGGAAGG - Intergenic
1115569840 14:34656048-34656070 CTGTGGCCAGAGAGTGAGGATGG + Intergenic
1115994444 14:39181197-39181219 CCTCAGGCTGAGAGGGAGGCTGG - Exonic
1117098790 14:52324240-52324262 CAGGAGGCAGAGAGGCAGGAGGG + Intronic
1117273296 14:54166939-54166961 CCTAAGGCAAAGGGTGAGGAGGG - Intergenic
1117521183 14:56552851-56552873 TGGCAGGGAGAGAGGGAGGATGG - Intronic
1118008413 14:61586066-61586088 CAGAAGGCAGAGAGGGAGGAAGG - Intronic
1118660637 14:68005962-68005984 CAGGAGGAAGAGAGAGAGGAAGG + Intronic
1119770860 14:77219917-77219939 CCTCAGCCAGGGAGTGGGGAGGG + Intronic
1120635313 14:86943863-86943885 AGGCAGGCAGAGAGGAAGGAAGG - Intergenic
1120930608 14:89844647-89844669 GGGAAGGCTGAGAGTGAGGAAGG - Intronic
1121664263 14:95660045-95660067 CAGCAGGATCAGAGTGAGGAAGG - Intergenic
1121843496 14:97154147-97154169 AAGGAGGGAGAGAGTGAGGAAGG - Intergenic
1122293674 14:100693240-100693262 CCACCGGCAGAAAGTGAGGCTGG + Intergenic
1122597598 14:102903969-102903991 AAGCAGGCAGAGAATGAGGTTGG + Intronic
1122764270 14:104054715-104054737 CGGCTGGCACAGAGTGTGGAGGG + Intergenic
1122795992 14:104206487-104206509 CCGCAGCCTGAGAGGGAGGGAGG + Intergenic
1122804313 14:104248905-104248927 CTGCAGGCAGAGGTTGAGGAGGG - Intergenic
1122946044 14:105010114-105010136 CCGCAGGCAGGGAGTGAGCTGGG - Exonic
1123058603 14:105584232-105584254 CAGCAGGAAGAGGGTGAGGAAGG + Intergenic
1123082934 14:105704466-105704488 CAGCAGGAAGAGGGTGAGGAAGG + Intergenic
1123164771 14:106315666-106315688 CAGCAGGGAGAGGGTGAGCAGGG - Intergenic
1123552622 15:21397790-21397812 TGGCAGGCAGCGAGTGAGGTTGG - Intergenic
1123588868 15:21835178-21835200 TGGCAGGCAGTGAGTGAGGTTGG - Intergenic
1123714724 15:23019334-23019356 CCTGAGGCAGAGAGTGTGCACGG + Exonic
1124110200 15:26778147-26778169 CAGGAGGAAGAGAGAGAGGAGGG + Intronic
1125293507 15:38176112-38176134 CCGCAGGTAGGAAGTAAGGAAGG + Intergenic
1125434394 15:39629550-39629572 GCGCAGGCAGAGAGGGCTGAGGG - Intronic
1125674870 15:41496368-41496390 CCCCAGGCAGAGAGGTAGGCAGG - Intronic
1125722775 15:41853128-41853150 GCGCAGGCAGGGAGAGAGGCTGG - Intronic
1126032289 15:44511084-44511106 ACACAGGCAGAGAATGAGGGAGG - Intronic
1126173698 15:45715973-45715995 CCAGAGGCAGAGAGTAGGGATGG - Intergenic
1127196485 15:56591468-56591490 CAGGAGGAAGAGAGTGAGGTGGG + Intergenic
1127267111 15:57371336-57371358 CAGCAGGCCCAGAGTGTGGATGG + Intergenic
1127875630 15:63109048-63109070 CAGCAAGGAGAGAGTGGGGATGG - Intergenic
1128221276 15:65970374-65970396 CTGCAGGCCGAGGGTGAGGAGGG + Intronic
1128278216 15:66372226-66372248 CTTGAGGAAGAGAGTGAGGAAGG - Intronic
1128605692 15:69035306-69035328 AGGCAGACAGAGAGTGAGGCAGG + Intronic
1129163159 15:73758898-73758920 CAGCAGCCAGAGAGGCAGGAAGG - Intergenic
1129241008 15:74252264-74252286 CCCCAGCCAGACAGGGAGGAAGG - Intronic
1130231304 15:82099383-82099405 CCTGAGGAAGAGGGTGAGGAGGG - Intergenic
1130296311 15:82648714-82648736 GCAAAGGCAGAGAGGGAGGACGG + Intronic
1130555849 15:84922143-84922165 CTGCAGGGAGGGAGTGTGGATGG - Intronic
1130995778 15:88903216-88903238 GGGGAGGCTGAGAGTGAGGAGGG - Intronic
1131159515 15:90095744-90095766 CCGGAGGCAGTGAATGTGGAAGG + Intronic
1202960971 15_KI270727v1_random:125010-125032 TGGCAGGCAGTGAGTGAGGTTGG - Intergenic
1132838957 16:1968948-1968970 CCGCAGGCACAGAGGCAGGCAGG - Exonic
1133003018 16:2860614-2860636 CGGGAGGCAGAGAGGGAGGCTGG - Intergenic
1134012928 16:10868651-10868673 CTGCAGCCAGGGAGAGAGGAAGG - Intergenic
1134781830 16:16905189-16905211 CAGGAGGAAGAGAGTGAAGAGGG - Intergenic
1136526660 16:30835293-30835315 GAGCAGGCAGAGGGTGAGGCAGG + Intronic
1137337022 16:47559677-47559699 TCCCAGGCAGAGAGTTAGGTGGG + Intronic
1137606923 16:49793224-49793246 CAGCAGGCACAGAGGAAGGAGGG + Intronic
1139259270 16:65576563-65576585 CAGGAGTGAGAGAGTGAGGAAGG + Intergenic
1139324827 16:66144484-66144506 TGGCAGGCAGATTGTGAGGAGGG - Intergenic
1139691672 16:68645607-68645629 CCGAGGGCAGAGAGTGAAGGAGG - Intronic
1141405942 16:83793132-83793154 CAGAAGCCTGAGAGTGAGGAAGG + Intronic
1141669731 16:85485481-85485503 CCACAGGCAGAGCCTGAGCAGGG - Intergenic
1142002060 16:87669805-87669827 CTGCAGGCAGCCAGTGTGGATGG + Intronic
1142117632 16:88368256-88368278 CCACGGGCAGATACTGAGGAGGG + Intergenic
1142360727 16:89625317-89625339 AGGGAGGCAGAGAGTGAGGGGGG + Intronic
1142478265 17:202502-202524 CAGCAGCAAGAGAGTGAGGCGGG + Intergenic
1142976615 17:3648454-3648476 GCTCAGGCAGGGAATGAGGAGGG - Intronic
1142993469 17:3747193-3747215 CCGGAGGCACATAGTGAGGAGGG + Intronic
1143161787 17:4876714-4876736 GCGGAGGCAGAAAGTGAGGATGG - Intronic
1143452309 17:7043302-7043324 CAGCAGGCAGCCAGTGAGGGGGG - Exonic
1143527770 17:7482412-7482434 CTCAAGGCAGAGGGTGAGGACGG - Exonic
1143852952 17:9826215-9826237 CAGCAGGACCAGAGTGAGGAAGG - Exonic
1144586586 17:16491459-16491481 CCGCAGGCAGAGAAGGAGGCTGG - Intronic
1144673582 17:17146731-17146753 AAGCAGGAAGGGAGTGAGGATGG - Intronic
1145347496 17:22050233-22050255 GCGCAGGGAGAGAGGAAGGATGG + Intergenic
1146230929 17:31108377-31108399 CGGGAGGCTGAGAGAGAGGATGG - Intronic
1146730989 17:35193858-35193880 CTCAAGGCAGAGAGTGAGGACGG + Exonic
1147322981 17:39657115-39657137 CCGGAGGCAGAGAGGGAGCAGGG + Intronic
1147702212 17:42403348-42403370 CAGCAGGCTGGGAGTTAGGAGGG - Exonic
1147945197 17:44076877-44076899 CCACAGGGAGAGAGTGGGTAAGG + Exonic
1148293212 17:46475253-46475275 CTGCAAGCAGAGAGGGAGCATGG + Intergenic
1148315397 17:46692956-46692978 CTGCAAGCAGAGAGGGAGCATGG + Exonic
1149595267 17:57861534-57861556 CCCCAGGCCGGGAGGGAGGAGGG + Exonic
1150267269 17:63839651-63839673 CTGCAGGCAGGGAGTTAGGGAGG - Intronic
1151385610 17:73753530-73753552 CAGGAGGCAGAGGGGGAGGAAGG + Intergenic
1151518833 17:74614296-74614318 CCCCAGGCAGAGTGGGATGAGGG - Intronic
1151965222 17:77427685-77427707 AGGCAGGCACAGAGTGTGGATGG - Intronic
1152072191 17:78139363-78139385 CCTCAGGCTGAGAGTGAAGACGG + Intronic
1152499225 17:80697100-80697122 CTACAGTCAGAGAGTGAGCAAGG + Intronic
1152680851 17:81667021-81667043 CCGCGGGCACAGACAGAGGAGGG - Intronic
1152730291 17:81966739-81966761 GCGCAGTCGGAGAGGGAGGAAGG + Intergenic
1152899081 17:82929720-82929742 CCGCAGGAAGAGAGTGGCGCTGG - Intronic
1153618883 18:6957684-6957706 CCAGAGGCAGAGGGTGAGCAAGG + Intronic
1153688294 18:7567560-7567582 CCGCTGGCAGAGGGAGCGGAGGG - Exonic
1153738720 18:8100094-8100116 AGCAAGGCAGAGAGTGAGGAGGG + Intronic
1154115511 18:11610023-11610045 CTCAAGGCAGAGGGTGAGGATGG - Intergenic
1157924529 18:51748895-51748917 ACCTAGGCAGAGGGTGAGGATGG - Intergenic
1159108789 18:64032398-64032420 CCCCAGGCTGGGAGCGAGGAAGG + Intergenic
1159673966 18:71258276-71258298 GTGAAGGGAGAGAGTGAGGATGG - Intergenic
1160004791 18:75061787-75061809 GAGCAGGACGAGAGTGAGGAGGG - Intronic
1160006917 18:75074850-75074872 CTCCAGGCCAAGAGTGAGGATGG + Intergenic
1160138521 18:76296622-76296644 CCGCCGCCAGAGAGGGGGGAGGG + Intergenic
1160761886 19:789603-789625 CCGCAGCCAGAGAGAAAGGCAGG - Intergenic
1160839708 19:1140623-1140645 GAGCAGGCAGAGAGCGGGGAAGG + Intronic
1160989386 19:1854318-1854340 CCCCCTCCAGAGAGTGAGGAGGG - Exonic
1161106052 19:2444641-2444663 TGGCACGCAGAGAGAGAGGATGG + Intronic
1161217024 19:3099688-3099710 CCAGAGGCAGGGAGTGGGGATGG - Intronic
1161290743 19:3492252-3492274 GCGCTGGCCGAGGGTGAGGAGGG - Exonic
1161353084 19:3804424-3804446 CATCAGGGAGAGAGGGAGGAAGG + Exonic
1161534739 19:4812007-4812029 CGACGGGCAGAGAGGGAGGAGGG - Intergenic
1161845016 19:6707378-6707400 CAGGAGCCAGAGAGGGAGGAGGG - Intronic
1161966374 19:7551218-7551240 CCGAAGCGAGAGAGTGAGGGCGG + Intronic
1161988383 19:7670054-7670076 CTGGAGGCAGGGAGTGAGGGTGG - Intronic
1161992016 19:7689531-7689553 CCCCAGGCACAGACTCAGGATGG - Intronic
1162365235 19:10244583-10244605 CAGGAGGCTGAGTGTGAGGATGG + Intergenic
1162976493 19:14209500-14209522 CAGGAGGCAAAGAGTGCGGAGGG + Intergenic
1163698381 19:18775227-18775249 CCGAGGGCAGAGGGTGAGGGGGG + Intronic
1163857877 19:19720171-19720193 CAGCAGGCAGAAAATGAGGAAGG + Intronic
1166017631 19:39994857-39994879 CAGGAGCAAGAGAGTGAGGAGGG - Intronic
1166698831 19:44870191-44870213 GTGGAGGCAGAGACTGAGGAGGG + Intronic
1166734492 19:45076119-45076141 CCGCGGGCCGAGGGCGAGGAGGG + Exonic
1166758998 19:45212978-45213000 TCCCAGGCAGGGAGTCAGGAGGG + Exonic
1166965292 19:46526230-46526252 CTGCCGGCAGAGAGGGAGGGAGG + Intronic
1167353660 19:48991190-48991212 CCCCAGCCAGAGAGCGAGGCAGG - Intronic
1167539110 19:50074186-50074208 CTCCAGGCAGAAAGAGAGGAAGG + Intergenic
1167740276 19:51320439-51320461 CACCAGGCGGAGAGGGAGGAAGG - Intronic
1167791954 19:51688754-51688776 CCACAGGCAGAGAAAGAGGATGG + Intergenic
1168092752 19:54096427-54096449 AGGCAGGCAGAGAGAGAGGGAGG - Intronic
1168092755 19:54096443-54096465 AGGCAGGCAGAGAGAGAGGCAGG - Intronic
1168092774 19:54096553-54096575 AGGCAGGCAGAGAGAGAGGGAGG - Intronic
1168276851 19:55283715-55283737 GCTGAGGCAGAGAGGGAGGAAGG - Intronic
1168401793 19:56089452-56089474 CCGGGGGCAGAGGATGAGGAAGG + Intronic
925234139 2:2263277-2263299 CTACTGGCAGAGAGCGAGGAGGG + Intronic
925693509 2:6549579-6549601 CAGGAGGAAGAGAGGGAGGAAGG - Intergenic
925895420 2:8468022-8468044 CCGGAGGTGGAGAGTGGGGATGG - Intergenic
926707564 2:15847399-15847421 CAGCAGCCAGAGAGTGTGGGTGG + Intergenic
927865736 2:26586111-26586133 CCGGGGGCAGAGAGAGAGGAGGG - Intronic
928113551 2:28528858-28528880 TCCCAGGCAGGGTGTGAGGAAGG + Intronic
928432012 2:31227992-31228014 CACCAGGCAGAGGGTGGGGAAGG + Intronic
930402755 2:50911319-50911341 AAGCAGGGAGAGAGTGATGAGGG - Intronic
930512193 2:52359259-52359281 CCCCAGGCAGGGGGTGAGGGTGG - Intergenic
930752197 2:54945047-54945069 GGGGAGGCAGAGAGGGAGGAGGG - Intronic
931917732 2:66977393-66977415 CCAGAGGCAGAGTCTGAGGAAGG - Intergenic
932659964 2:73643247-73643269 ATGCAGCTAGAGAGTGAGGAAGG + Intergenic
932666532 2:73702906-73702928 ATGCAGCTAGAGAGTGAGGAAGG + Intergenic
933277956 2:80303097-80303119 CCGCAGGCAGAGCGAGTGCAGGG + Exonic
936074917 2:109395628-109395650 GCGGAGACAGAGAGTGAGGGTGG - Intronic
936729300 2:115361086-115361108 CCTCAGGCAGAGGCTGAGGATGG + Intronic
937072271 2:119073326-119073348 AGGCAGGCAGGGAGGGAGGAAGG + Intergenic
937896360 2:126979378-126979400 CCCCATGTTGAGAGTGAGGAAGG - Intergenic
938232746 2:129675619-129675641 CCTCAGGGAGAGAGAGAGGCTGG - Intergenic
938289006 2:130139821-130139843 CCCCAGGGAGGGAGTGGGGAAGG - Intronic
938320035 2:130356374-130356396 CGGGGGGCAGAGAGTGAAGACGG - Intronic
938397954 2:130964341-130964363 CGACAGGCAGAAAGTGAGGGAGG - Intronic
938467523 2:131533117-131533139 CCCCAGGGAGGGAGTGGGGAAGG + Intronic
939321506 2:140628876-140628898 CAGGAGGAAGAGAGTGAAGAGGG - Intronic
939428626 2:142073822-142073844 CAGGAGGAAGAGAGAGAGGAAGG - Intronic
940148872 2:150577621-150577643 CAGCAGGAAGAGAGAGAGGAGGG + Intergenic
940683303 2:156813854-156813876 CGGCAGGCAGAGAATGGGTACGG - Intergenic
940913391 2:159228676-159228698 GCACAGCCAGAGAGGGAGGAAGG - Intronic
942629388 2:177939354-177939376 AAGGAGGGAGAGAGTGAGGAAGG + Intronic
947634789 2:231674460-231674482 CCTCAGGCATAAAGTGAGGTTGG + Intergenic
947944291 2:234087299-234087321 CAGCAGGCAGAAAATCAGGAAGG + Intergenic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169759862 20:9079479-9079501 GGACAGGCAGAGAGTGAGGAAGG - Intronic
1170319487 20:15079380-15079402 GTGCAGGGAGTGAGTGAGGATGG - Intronic
1171144109 20:22766760-22766782 CCACAGGAAAAGACTGAGGAAGG + Intergenic
1171347702 20:24478437-24478459 CCTCTGGCAGACAGTGAGGCTGG - Intronic
1171364073 20:24611651-24611673 CTCCAGGCAGAGGCTGAGGAGGG - Intronic
1172009507 20:31838177-31838199 TTCCAGACAGAGAGTGAGGAGGG + Intergenic
1172606036 20:36214700-36214722 CAGCAGAGAGAGAGAGAGGATGG + Intronic
1172702978 20:36863814-36863836 ACGCAGGCAGGGAGCGAGGGAGG + Intergenic
1172789218 20:37490987-37491009 CATCAGGCAGAGAGTGTAGAGGG - Intergenic
1173427827 20:42958246-42958268 AGGAAGGGAGAGAGTGAGGAAGG + Intronic
1174073384 20:47914558-47914580 CCTGAGGCAGAGTGAGAGGAAGG - Intergenic
1174201072 20:48806833-48806855 CAGCAGGCAGAAGGTGAAGAGGG + Intronic
1174362389 20:50037158-50037180 CAGCAGGCAGGCAGAGAGGATGG + Intergenic
1175093640 20:56524575-56524597 AGGCAGTCAGAGAGAGAGGATGG - Exonic
1175231027 20:57473419-57473441 CCGCAGGCAGAGAGGAAGAGAGG - Intergenic
1175314711 20:58039350-58039372 CCCCTGGCAGAGGGTGAGGCGGG - Intergenic
1175804167 20:61818223-61818245 CATCACGCAGACAGTGAGGAGGG + Intronic
1176134340 20:63514655-63514677 CAGCAGGAAGAGAGTGAAGGGGG + Intergenic
1176820648 21:13652118-13652140 TGGCAGGCAGCGAGTGAGGTTGG + Intergenic
1177807655 21:25889733-25889755 CAGGAGGCTGAGAGTGAGGTAGG + Intronic
1179249896 21:39663972-39663994 CCGCAGGCACCCAGAGAGGAAGG + Exonic
1179924824 21:44528672-44528694 CCGCATGCAGAGGCTGAGGCAGG - Intronic
1180224835 21:46386202-46386224 CAGCAGGCAGGGTGGGAGGAGGG - Intronic
1180590415 22:16932500-16932522 CTGAAGGCAGAAAGTGAGGCAGG + Intergenic
1180611648 22:17102101-17102123 ACGCAGGCTGGGAGTGAGGAGGG - Intronic
1180784024 22:18536975-18536997 CAGCAGGCAGAGAAAGAGAAGGG + Intergenic
1180832164 22:18911893-18911915 GGCCAGGCAGAGAGTGAGGCTGG + Exonic
1180929180 22:19577312-19577334 AAGCAAGCAGAGAGAGAGGAGGG - Intergenic
1180991668 22:19940995-19941017 CCACAGGCAGTGAGTGTAGAGGG - Intronic
1181067680 22:20314449-20314471 GACCAGGCAGAGAGTGAGGCTGG - Exonic
1181127592 22:20711023-20711045 CAGCAGGCAGAGAAAGAGAAGGG + Intronic
1181240924 22:21476327-21476349 CAGCAGGCAGAGAAAGAGAAGGG + Intergenic
1181308510 22:21930816-21930838 CCACAGGCTGTGGGTGAGGAAGG - Intronic
1182120925 22:27786187-27786209 CTGAAGGCAGAGAGACAGGAAGG + Intronic
1182715507 22:32353955-32353977 CCGGAGGCAGGGAGTGAGTTGGG - Intergenic
1182745617 22:32603578-32603600 CCGAAGCCAGACAGTGAAGACGG + Intronic
1183264878 22:36818984-36819006 CAGCAGGGAGAGATGGAGGAAGG - Intronic
1183912769 22:41091874-41091896 CGGGAGCCAGAGAGTGCGGAGGG + Exonic
1184637713 22:45848246-45848268 CAGGAGGAAGAGAGTGAGGGTGG + Intergenic
1185271368 22:49930668-49930690 ACGCAGGCACACACTGAGGATGG + Intergenic
1185276996 22:49954081-49954103 CCGCAGGAGGAGAGTGTGGAAGG + Intergenic
1185296636 22:50058069-50058091 CCGAAGGCAGATGGGGAGGAGGG + Intergenic
1185359048 22:50394188-50394210 CCGCAGGCAGTGTCTGAGGATGG + Intronic
1203282249 22_KI270734v1_random:137198-137220 GGCCAGGCAGAGAGTGAGGCTGG + Intergenic
949731927 3:7123677-7123699 AAGCAGGGAGTGAGTGAGGAAGG - Intronic
951959481 3:28300717-28300739 AGGCAGGGAGAGAGGGAGGAAGG - Intronic
952590149 3:34942640-34942662 AGGGAGGCAGAGAGAGAGGAAGG - Intergenic
952978501 3:38716425-38716447 CAGCAGGCAAAGAGAGAGGTTGG - Intronic
953041791 3:39262038-39262060 CTGCAGGCAGATAATGAGGCAGG - Intergenic
953091153 3:39727184-39727206 CAGTAGCAAGAGAGTGAGGATGG + Intergenic
953140013 3:40220796-40220818 CAGGAGGAAGAGAGTGAGGGAGG + Intronic
953495991 3:43387407-43387429 CGGCAGGGAGAGCTTGAGGAGGG + Intronic
953675088 3:44994816-44994838 CAGCAGTCAGACAGAGAGGAAGG - Intronic
953694560 3:45147217-45147239 CCACAGGCAGAGATTGCGGATGG + Intergenic
954879904 3:53827270-53827292 CAGTAGGAAGAGAGAGAGGAGGG - Intronic
955393429 3:58537359-58537381 ATGCAGGAAGAGAGGGAGGAAGG - Intergenic
956289673 3:67648289-67648311 CTGAAGCCAGAGAGAGAGGAAGG + Intronic
957078374 3:75618765-75618787 CGGCTGGCAGAGACAGAGGAGGG - Intergenic
958263672 3:91412172-91412194 AAGCAGGCAGAAAGTCAGGAAGG - Intergenic
958757957 3:98272479-98272501 CAGCAGGCTGACAGTGCGGACGG + Intergenic
959351969 3:105276979-105277001 AAGCATGCAGAGAGAGAGGAGGG + Intergenic
959376625 3:105595583-105595605 GAGTAGGCAGAGAGTGATGAGGG + Intergenic
959686960 3:109158003-109158025 CAGAAGACAGAGAGTGAGGGGGG + Intergenic
960319895 3:116221736-116221758 CTCCAGGGCGAGAGTGAGGATGG - Intronic
964490145 3:157227574-157227596 CAGGAGCAAGAGAGTGAGGAGGG + Intergenic
965294322 3:166924218-166924240 CCGCAGGAAAAGAGAGAGGGAGG + Intergenic
965699062 3:171440709-171440731 CTGCAGGAAGAGGGTGTGGAGGG + Intronic
966754226 3:183353590-183353612 CAGGAGGAAGAGAGTGAGGGAGG + Intronic
967521146 3:190434412-190434434 CAGCAGGCAAAGAGAGAGTAAGG - Intronic
968206532 3:196807206-196807228 CTGCAGGTAGAGTGTGCGGAAGG + Intronic
968964740 4:3764190-3764212 GCGATGGCAGAGAGTGAGGGGGG - Intergenic
969021443 4:4142738-4142760 CGGCTGGCAGAGACAGAGGAGGG - Intergenic
969038792 4:4277457-4277479 CCACAGGGAGAGAGGGAGGGAGG + Intronic
969131783 4:4995534-4995556 AAGCAGGCAGAGAAGGAGGAAGG + Intergenic
969342437 4:6550566-6550588 CCTCATGCAGGGAGTGAGGAGGG - Intronic
969574743 4:8030315-8030337 CAGCAGGCAGAGTGGGAGGCAGG + Intronic
969575228 4:8032718-8032740 CGCCAGGCAGAGAGGGAGGAGGG + Intronic
969691399 4:8706027-8706049 CCTCAGGCAGAGTGCGAGGTGGG - Intergenic
969719066 4:8883094-8883116 CCTCAGGCAGAGAGTGGAGAGGG + Intergenic
969792001 4:9498761-9498783 CGGCTGGCAGAGACAGAGGAGGG + Intergenic
969908394 4:10419548-10419570 CAGAAGGAAGAGAGTGAGGGGGG - Intergenic
970410291 4:15799868-15799890 GCTCAGGCACAGAGGGAGGAGGG + Intronic
971376370 4:26058921-26058943 CAGCAGGCAGAAAGTTGGGATGG - Intergenic
972793875 4:42397845-42397867 CCGCAGGCCGGGAGTCAGCATGG - Exonic
973726502 4:53782299-53782321 CAGCAGGCAAAGAGGGAGGATGG - Intronic
973816412 4:54623418-54623440 CTGCTGGAACAGAGTGAGGAAGG - Intergenic
974813172 4:66972120-66972142 CCGCAGGAAGAGGCTGAAGAGGG - Intergenic
976199097 4:82561808-82561830 CCGCAGGCGGAGACCGGGGACGG - Intronic
976532891 4:86175578-86175600 CAGGAGGAAGAGAGAGAGGAGGG - Intronic
977271101 4:94917970-94917992 CAGGAGAAAGAGAGTGAGGAGGG - Intronic
978919186 4:114161992-114162014 CCCCAGGCAGAGAGGGAAGAAGG + Intergenic
980162131 4:129177552-129177574 CTGCATGAAGAGATTGAGGATGG + Intergenic
981819141 4:148866338-148866360 CAGCACACAGAGAGTGAGGCAGG + Intergenic
982270138 4:153577969-153577991 CCCCTGGGAGAGAGTGAAGAGGG + Intronic
983372565 4:166879895-166879917 CAGGAGGCAGAGAGAGAAGAGGG - Intronic
984285503 4:177723444-177723466 CCGTAGCCATAGAGTGAGGATGG - Intergenic
985947967 5:3201327-3201349 CAGAAGCCAGAGAGTCAGGAGGG - Intergenic
986093572 5:4534915-4534937 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
988682157 5:33494154-33494176 CCTGAGGCAGAAAGTCAGGAGGG + Intergenic
989069628 5:37497182-37497204 ACGGAGGCAGGGAGTGAGGGGGG - Intronic
990304337 5:54480120-54480142 CAGGAGGAAGAGAGAGAGGAGGG - Intergenic
990497505 5:56363313-56363335 CCGCAGGTATAGAGTGAAAATGG - Intergenic
990658745 5:57988216-57988238 AAGAAGGGAGAGAGTGAGGAAGG - Intergenic
990991532 5:61689167-61689189 CCCTAGGCAGAGAATGAGGCTGG + Intronic
991543195 5:67752254-67752276 CTGCAGGGAGAGAGTGAGACTGG + Intergenic
994815102 5:104576159-104576181 GGGCAGGGAGAGAGAGAGGAGGG - Intergenic
994849769 5:105039109-105039131 CAGAAGGAAGAGAGAGAGGAGGG - Intergenic
995725778 5:115179491-115179513 CCGCAGTCAGAGCGTGTGGCCGG - Intronic
995845266 5:116487298-116487320 CCAGAGGCAGCTAGTGAGGATGG - Intronic
996710466 5:126538192-126538214 CCGGAGGAAGAAAGTGAGGGGGG - Intergenic
996876980 5:128250862-128250884 CAGGAGGAAGAGAGAGAGGAGGG - Intergenic
997354676 5:133254647-133254669 CCGCAGTCATACAGTGAAGACGG + Intronic
997496027 5:134326995-134327017 CACCAGGCAGAGAGTGGGGAAGG - Intronic
997804949 5:136907583-136907605 TCGCAGGCAAGGAGTGAGCAAGG - Intergenic
997839188 5:137223142-137223164 GGGCAGGAAGAGACTGAGGATGG + Intronic
997950743 5:138240992-138241014 CCACAGGCACAGACTGAGGGTGG - Intergenic
998414545 5:141936779-141936801 TCCCAGGCAGAGATTCAGGAAGG + Intronic
999082155 5:148854956-148854978 CTGCAGATAGAGTGTGAGGAAGG + Intergenic
999189079 5:149732902-149732924 ACCCAGCCAGAGAGTGGGGAAGG - Intronic
999244631 5:150147349-150147371 TCCCAGGCTGAGACTGAGGAGGG + Intronic
1002819396 6:710894-710916 ACGCAGGCACAGGGTGAGGGTGG + Intergenic
1003487351 6:6591146-6591168 CTGCAGGCAGAGGGTGAGTCTGG - Intronic
1003787989 6:9508557-9508579 CCATACGCAGAGATTGAGGAAGG - Intergenic
1003848235 6:10196194-10196216 CCGCAGGCAGAGAGTGAGGAAGG - Intronic
1004281047 6:14280257-14280279 TTGCAGGCAGAGAGGGAGCAAGG + Intergenic
1004458495 6:15813906-15813928 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1004481185 6:16020833-16020855 CAGAAGCCAGAGAGAGAGGAGGG - Intergenic
1006335123 6:33416362-33416384 CTGGGGGCAGAGACTGAGGAGGG + Exonic
1007226912 6:40321552-40321574 AGGCAGGCAGGGAGTGGGGATGG + Intergenic
1007269397 6:40624633-40624655 CCGCTAGCAGGGAGTGGGGAAGG + Intergenic
1007280877 6:40711356-40711378 ACACAGGGAGAGAGTGAGGTTGG + Intergenic
1007301223 6:40869359-40869381 CAGGACTCAGAGAGTGAGGAGGG + Intergenic
1008516333 6:52322986-52323008 CAGCAGCCAGAGCCTGAGGAGGG - Intergenic
1008526572 6:52413212-52413234 GGGCAGGCAGAGAGAGAGAATGG + Intergenic
1008991758 6:57610800-57610822 AAGCAGGCAGAAAGTCAGGAAGG + Intronic
1009447816 6:63763962-63763984 AGGCAGGCAGGGAGTGAGGGAGG - Intronic
1009652977 6:66499901-66499923 CAGAAGGAAGAGAGAGAGGAAGG - Intergenic
1010604490 6:77871543-77871565 TAGCAGGGAGAGAGGGAGGAGGG + Intronic
1011406859 6:87024719-87024741 CTGCAGGCAGAGAATAAGGGTGG - Intergenic
1014701933 6:124699615-124699637 CAGCAGCAAGAGAGTGGGGAAGG - Intronic
1015026632 6:128541305-128541327 AGGCAGGGAGAGAGGGAGGAAGG - Intergenic
1015970722 6:138740587-138740609 CGGCAGGCAGAGAGAGAGACTGG + Intergenic
1017233701 6:152098474-152098496 CTGCAGGGAGAGTGTGAGGGTGG + Intronic
1017455813 6:154600321-154600343 CCACAGGCAGTGAGTGTGGAAGG + Intergenic
1018385638 6:163300477-163300499 CTGCAGGAAGAGAGTGAGGGCGG - Intronic
1019192884 6:170263713-170263735 CCACAGGCAGAGACTCAGGTTGG + Intergenic
1019398437 7:836229-836251 CCTCCTGCAGAGAGAGAGGAGGG + Intronic
1019699926 7:2469749-2469771 GGGCAGGGAGAGAGGGAGGAAGG + Intergenic
1020308866 7:6854767-6854789 CGGCTGGCAGAGACAGAGGAGGG - Intergenic
1021710222 7:23408956-23408978 CCACGGACAGAGAGTGGGGATGG + Intronic
1021841640 7:24726032-24726054 CGGCAGGCAGAGATGGAGGGAGG + Intronic
1022635790 7:32133505-32133527 CTGCTGCCAGGGAGTGAGGAAGG + Intronic
1022807485 7:33837362-33837384 CCTCAGACAGTGGGTGAGGATGG + Intergenic
1023269474 7:38445938-38445960 CAGGAGGAAGAGAGAGAGGAGGG - Intronic
1023528316 7:41128263-41128285 CCACTGGCAGAGAATGATGAAGG - Intergenic
1023619502 7:42055467-42055489 CAGCTAGCAGAGAGGGAGGAGGG - Intronic
1024281098 7:47720595-47720617 CCGCATGCAGATGGTGATGATGG + Intronic
1024374024 7:48617994-48618016 CCTGGGGCAGAGAGTGAGGTAGG - Intronic
1024598876 7:50962420-50962442 CAGCACCCAGAGGGTGAGGAGGG + Intergenic
1026280749 7:68919796-68919818 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1026622932 7:71966518-71966540 CAGGAGACAGAGAGAGAGGAGGG - Intronic
1026982533 7:74535239-74535261 CCTCAGGCAGGGAGGGAGGCTGG + Intronic
1028117298 7:87013551-87013573 CAGCAGGGATGGAGTGAGGAAGG + Intronic
1028528202 7:91808857-91808879 CATCAGGCTGAGAGTGCGGAAGG - Intronic
1029413980 7:100431534-100431556 CCGGGGGCAGAGGGTGAGGAAGG + Exonic
1029590095 7:101501588-101501610 CAACAGGCAGAGAGTGACAAGGG - Intronic
1030617869 7:111757115-111757137 GCGGAGGCTGAGAGGGAGGAGGG + Intronic
1030678429 7:112408870-112408892 ACAGAGGCAGGGAGTGAGGAAGG - Intergenic
1032081455 7:128860508-128860530 AGGGGGGCAGAGAGTGAGGATGG - Intergenic
1032422957 7:131797900-131797922 CTCCAGGCAGACAGTGAGTAGGG + Intergenic
1032685289 7:134226832-134226854 TGGTAGGCAGGGAGTGAGGAAGG + Intronic
1033472926 7:141665366-141665388 CCGCAGGCTCCGAGGGAGGAAGG - Intronic
1033600658 7:142886127-142886149 GGGGAGGCAGAGAGTGAGGCAGG - Intergenic
1033643815 7:143286245-143286267 CTACAGGGAGAGAGGGAGGATGG - Intronic
1034212031 7:149372431-149372453 CAGGAGGAAGAGAGTGAAGAAGG + Intergenic
1034676923 7:152898598-152898620 CTGTAGCCAGAGAGTGGGGATGG + Intergenic
1034974417 7:155439527-155439549 CAGCAGTCAGGGTGTGAGGAGGG + Intergenic
1036656390 8:10679915-10679937 CCTCAGCTGGAGAGTGAGGAAGG + Intronic
1037940213 8:22945590-22945612 CTGGAGGCAGAGAGTGGGGATGG - Intronic
1038084004 8:24173653-24173675 GGCCACGCAGAGAGTGAGGAGGG + Intergenic
1038455091 8:27667734-27667756 GAGCAGGCAGAGAGTGAGCAGGG + Intronic
1038636656 8:29292863-29292885 ACCCAGGCAGAGACTGAAGAGGG - Intergenic
1038697464 8:29819029-29819051 CTGCAGGCAGGTAGTGTGGAGGG - Intergenic
1039215797 8:35269320-35269342 CCCCAGACAGAGAGACAGGAAGG - Intronic
1039771691 8:40694201-40694223 CTGCAGGCAGTAAGGGAGGATGG + Intronic
1041301278 8:56414438-56414460 CCGAAGGCAGAGAGGAAAGATGG + Intergenic
1042035919 8:64533796-64533818 CCGAAGGCAGAGAGGTATGAGGG + Intergenic
1042089253 8:65140822-65140844 CCGCTGGAACAGAGTGAGAACGG + Intergenic
1043283582 8:78501356-78501378 CAGGAGGCAGAGAGAGAGCAAGG + Intergenic
1043383709 8:79728724-79728746 CAGGAGGAAGAGAGTGAGGGGGG - Intergenic
1043744358 8:83855075-83855097 GAGCAGGGAGAGAGGGAGGAAGG + Intergenic
1045728343 8:105202688-105202710 CAGCAGGCAGAAAATAAGGATGG - Intronic
1048167341 8:132075169-132075191 CTGCAGGCTGAGAGTAAGGCTGG + Intronic
1048606169 8:135971091-135971113 ATCCAGGCAGAGAGTGAGGGAGG - Intergenic
1048801099 8:138194293-138194315 GCGGAGGCAGAGACAGAGGAGGG - Intronic
1049146057 8:141001589-141001611 CCGCTGGCGGAGAGCGAGGCAGG - Intronic
1049262121 8:141645517-141645539 CTGCAGGGAGGGAGTGGGGAGGG - Intergenic
1049502670 8:142975671-142975693 GCGCAGGCTGAGAGAGAGCAGGG + Intergenic
1051274651 9:15387166-15387188 CAGCAGGAAGAGAGAGAGGAGGG - Intergenic
1051343742 9:16134022-16134044 CCGCAGGCACTAAGTGAGCACGG + Intergenic
1055339379 9:75264594-75264616 ACCAAGGCAGGGAGTGAGGAAGG + Intergenic
1055775623 9:79764389-79764411 CCAGAGGCAGAGAATAAGGATGG - Intergenic
1055996036 9:82161096-82161118 TGGCAGGCAGAGAGTGAATAAGG - Intergenic
1056955836 9:91080385-91080407 GCTCAGACAGAGAGTGATGAGGG + Intergenic
1057241044 9:93409556-93409578 CAGCAGGAGGAAAGTGAGGATGG - Intergenic
1057242782 9:93426873-93426895 GTGCAGGAGGAGAGTGAGGATGG + Intergenic
1057390584 9:94639092-94639114 CCCCAGGCAGACAGACAGGACGG + Intronic
1058756373 9:108086491-108086513 CCTCAGGGAGAGGATGAGGAGGG + Intergenic
1060898935 9:127240429-127240451 CCACAGGGTGGGAGTGAGGATGG - Intronic
1061168601 9:128939028-128939050 ACTCAGGCAGAGAGTGGGGATGG - Intronic
1062361917 9:136192403-136192425 CTGCCGGCAGATGGTGAGGAGGG + Intergenic
1062468091 9:136690328-136690350 GCTCAGGGAGCGAGTGAGGACGG + Intergenic
1062468898 9:136693624-136693646 AGGCAGGGAGAGAGAGAGGAGGG + Intergenic
1185877259 X:3711737-3711759 GGGAAGGCAGAGAGAGAGGAGGG + Intronic
1186536198 X:10351223-10351245 CCCCAAGCAGAGAGGGAGTATGG - Intergenic
1189247028 X:39571287-39571309 CCTAAGGCAGAGAGTGTGCAGGG - Intergenic
1191993945 X:67069719-67069741 AGGCAGCCAGAGAGAGAGGATGG + Intergenic
1192118058 X:68430210-68430232 CCGCTGGCACAGTGTGAGGAAGG + Intronic
1192196059 X:69028991-69029013 CCACAGGCAGAGATTGGTGAGGG + Intergenic
1193322558 X:80139844-80139866 CAGCAGGCAGAGTGTCAGGAGGG - Intergenic
1194106151 X:89769439-89769461 CAGCAGACAGAGAGAGAGCAAGG - Intergenic
1195306154 X:103585802-103585824 CAGTGGGCAGAGGGTGAGGAAGG + Intronic
1195681050 X:107546974-107546996 CCTCATGCAGAGATGGAGGAGGG - Intronic
1195907263 X:109856761-109856783 GAGAAGGCAGAGAGAGAGGATGG + Intergenic
1199063872 X:143390761-143390783 ACGGAGGGAGAGAGGGAGGAAGG + Intergenic
1199081341 X:143579801-143579823 CCACTGCCAGAGATTGAGGAGGG + Intergenic
1200060933 X:153483482-153483504 TCGGAGGCAGAGAGCAAGGATGG + Intronic
1200137971 X:153884068-153884090 AGGGAGGCAAAGAGTGAGGAAGG - Intronic
1200175419 X:154112047-154112069 CAGCAGGCAGAAAATCAGGAAGG - Intergenic
1200458107 Y:3417298-3417320 CAGCAGACAGAGAGAGAGCAAGG - Intergenic
1201550118 Y:15210447-15210469 AGAAAGGCAGAGAGTGAGGAAGG + Intergenic
1201890903 Y:18942811-18942833 ACAGAGGGAGAGAGTGAGGAGGG + Intergenic