ID: 1003849658

View in Genome Browser
Species Human (GRCh38)
Location 6:10208872-10208894
Sequence TCTCTATGTTGAAGGAGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 218}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003849658_1003849664 13 Left 1003849658 6:10208872-10208894 CCCACTCTCCTTCAACATAGAGA 0: 1
1: 0
2: 0
3: 22
4: 218
Right 1003849664 6:10208908-10208930 TGTGCTCTGACCTCCCCAGCTGG 0: 1
1: 0
2: 3
3: 21
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003849658 Original CRISPR TCTCTATGTTGAAGGAGAGT GGG (reversed) Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
903890695 1:26568425-26568447 TCTCTATGTTGTATTAGGGTAGG + Intronic
904317687 1:29676463-29676485 TCTCTATGTGGGAGGTGAGATGG - Intergenic
905678615 1:39849235-39849257 TCTCTATTTTACAGGAGAATTGG + Intronic
906628376 1:47344280-47344302 GCTCAATTTTGAAGGACAGTGGG + Intronic
908161646 1:61414446-61414468 GCTCTAGGTTGAAGGTGAATTGG - Intronic
909169710 1:72280817-72280839 TGTCTAAGGTGAAAGAGAGTGGG - Intronic
909539463 1:76774724-76774746 TCTCCGTCTGGAAGGAGAGTTGG - Intergenic
910110414 1:83676681-83676703 TCTGAATGTTGAAGGTCAGTTGG - Intergenic
910602795 1:89049929-89049951 TCTCAATCTTGAGGGAGAATGGG - Intergenic
910871515 1:91837569-91837591 TGTCTCTGTTGAAGTAGACTCGG - Intronic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
913339355 1:117742617-117742639 TTTCTTTGTTGAAGAACAGTTGG + Intergenic
915267313 1:154728295-154728317 TCTCTATGTTGAAAGAAACTGGG - Intronic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
915937943 1:160099748-160099770 TCTCTATGTTCAGTGACAGTGGG + Intergenic
919917060 1:202145087-202145109 TTTTCAGGTTGAAGGAGAGTGGG + Intergenic
924023951 1:239813556-239813578 TCTCTATTTTGGAGAAGACTAGG - Intronic
1064158693 10:12925042-12925064 TCTGTGTGTTGAAGGAGAGGGGG + Intronic
1066120748 10:32284316-32284338 TCTCTATGTTAAAGCAAACTAGG + Intronic
1069708820 10:70476344-70476366 ACTGAATGTTGAAGGAGAGAAGG - Intergenic
1069781968 10:70962571-70962593 TATCCATGTGGAAGGAGGGTTGG - Intergenic
1072639489 10:97200828-97200850 TTTGTATGTTGAGGGAGATTTGG + Intronic
1072907060 10:99464204-99464226 GCTTTATGTTGAAGCACAGTAGG - Intergenic
1074984231 10:118643017-118643039 TCTCAAACTTGAAGGACAGTAGG - Intergenic
1075466012 10:122650673-122650695 TCTCTATGGTCAAGGAGGCTTGG + Intergenic
1077958133 11:7043498-7043520 TCTATATGTTGAAAGGCAGTTGG + Exonic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1081099654 11:38986414-38986436 GCTCTATCTTGAAGCAGGGTAGG + Intergenic
1081725841 11:45328528-45328550 TCTTTGTGCTGATGGAGAGTTGG - Intergenic
1084056407 11:66636706-66636728 TCTCCAGATTGAAGGAGACTGGG - Intronic
1085740699 11:79076068-79076090 TGTCTGTGGAGAAGGAGAGTAGG + Intronic
1086891523 11:92264314-92264336 TGTATATGTTTCAGGAGAGTAGG + Intergenic
1087032212 11:93717008-93717030 TCCCTATGTTGAAGGAGTGCTGG + Intronic
1087777726 11:102271867-102271889 TCTGTATGTGGAAGGATAGAAGG + Intergenic
1088381341 11:109196556-109196578 CCTCTATGTTGAAGGAATTTGGG + Intergenic
1089955263 11:122564732-122564754 TGTCTTTGTTGAAGATGAGTTGG - Intergenic
1090393807 11:126406289-126406311 TCTTCATCTTGAAGGACAGTGGG + Intronic
1090757940 11:129811075-129811097 TTTCTTTGTTGAAGATGAGTTGG - Intergenic
1091232674 11:133998859-133998881 CCTCTACTTTGAAAGAGAGTTGG - Intergenic
1092757488 12:11777397-11777419 TCTCTAGGTAGAAGGATTGTGGG + Intronic
1093051150 12:14506394-14506416 TCTCTATCTGGAAGCAGACTGGG - Intronic
1093254561 12:16850750-16850772 TCTCTATGATGTTGGAGTGTGGG + Intergenic
1093548951 12:20383901-20383923 TCTCTGTGTTGAGTGAGAGTAGG + Intronic
1093895855 12:24573530-24573552 TCTCTATTTTTTAGGGGAGTGGG + Intergenic
1094365555 12:29676349-29676371 TCTTCATATTTAAGGAGAGTGGG - Intronic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096761161 12:53843194-53843216 TCTTTTTGTAGAAGGAAAGTAGG + Intergenic
1096945429 12:55402231-55402253 TCTTTCTGATGAAGCAGAGTTGG - Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1098516096 12:71377632-71377654 TGACTTTGTTGAAGGTGAGTTGG + Intronic
1100172630 12:91992955-91992977 CCTCTATGTTGAGGGAGACAAGG + Intronic
1101554078 12:105790806-105790828 TCTCCACGGTGAAGGAGAGCAGG - Intergenic
1106557076 13:30818968-30818990 TCTTTATCTTAAAGGAGACTGGG - Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108337790 13:49463826-49463848 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1112514750 13:100043837-100043859 TCTCTACATTAGAGGAGAGTAGG - Intergenic
1116360175 14:43984344-43984366 TGAATATCTTGAAGGAGAGTCGG - Intergenic
1116395984 14:44449209-44449231 TCCTTATGTTGAGGGAGTGTTGG + Intergenic
1116398957 14:44481676-44481698 TCCCTGAGTTGAATGAGAGTGGG - Intergenic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1120324495 14:83007741-83007763 ACTCTGAGATGAAGGAGAGTTGG + Intergenic
1122480231 14:102042474-102042496 TCTCCATGGTGAGGAAGAGTCGG - Exonic
1125360000 15:38855114-38855136 TCTTTATGCTGATGGAGAGGTGG - Intergenic
1126991619 15:54384366-54384388 AATCTATGTTGAAGATGAGTTGG - Intronic
1128094234 15:64941817-64941839 TTCCACTGTTGAAGGAGAGTTGG + Intronic
1132937938 16:2491185-2491207 TCTGTATGTGGAAGGGGAGTAGG + Intronic
1133150612 16:3826378-3826400 TCACTATGTTTAAGGATAGGGGG - Intronic
1136108181 16:28046057-28046079 TCTCTATTTTGAAGATGAATGGG + Intronic
1137814438 16:51385131-51385153 TGTTTATGTTAAAGAAGAGTAGG - Intergenic
1138926650 16:61599806-61599828 TCTGTCTGTTGAAGGATATTAGG + Intergenic
1141463360 16:84191412-84191434 TCTCGGTGTTGAGGGACAGTGGG + Exonic
1141723533 16:85770756-85770778 TTTCTATGTTGATGGATATTTGG - Intergenic
1142152004 16:88516790-88516812 TCTCTTTGTAGAAGGAGAAGGGG + Intronic
1142281715 16:89152144-89152166 ACTCTGTGTTGAATGAGACTGGG - Intronic
1143623015 17:8091710-8091732 TCTCTGTGTCTTAGGAGAGTGGG - Intergenic
1143623566 17:8095225-8095247 TCTCTATGTTTAAGGGCTGTGGG + Intergenic
1145105089 17:20108702-20108724 CCTCTCTGTTGAAGGACATTTGG + Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1147517057 17:41128959-41128981 GTACTATGTTGAAGAAGAGTGGG - Intergenic
1148028794 17:44606088-44606110 TCTCTGTGTCGTAGGAGAGAGGG + Intergenic
1149850946 17:60033338-60033360 TCTCCATGTGGCAGGAGAATAGG + Intergenic
1149859220 17:60113186-60113208 TCTCCATGTGGCAGGAGAATAGG - Intergenic
1150752159 17:67874234-67874256 TGTCTAAGTTGAAAGAGGGTAGG + Intronic
1151165334 17:72198485-72198507 TCTCTGTGGTAATGGAGAGTGGG - Intergenic
1154038226 18:10827804-10827826 TCTCTAAGTTGAAGCAGGATTGG - Intronic
1154511713 18:15111189-15111211 TGTCTATGCTGAAGGATTGTTGG + Intergenic
1155818435 18:30345607-30345629 TGTCTCTGAGGAAGGAGAGTTGG - Intergenic
1156463702 18:37335734-37335756 TCTCTAAGGGGTAGGAGAGTGGG - Intronic
1158027324 18:52915825-52915847 TTTCTATGTTGAAGGAAAATGGG + Intronic
1159054777 18:63452762-63452784 TCCCTATGTTGAAGGAGTGCTGG - Intergenic
1161739973 19:6015020-6015042 TCTTTCTGTTAGAGGAGAGTTGG + Intronic
1161872347 19:6879928-6879950 AGTCTATGTTCAAGGAGAGAGGG + Intergenic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1163939310 19:20477854-20477876 TCTCTACTTTGGAGGGGAGTTGG + Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1165971194 19:39631719-39631741 TCTCTATTTTAAAGAAGAGCAGG - Intergenic
1167496281 19:49820597-49820619 TCTCTATGTTGAGGGAGTGCTGG + Intronic
926069393 2:9873496-9873518 TCTATACTTTGAAGGAGAGGTGG - Intronic
927132717 2:20073982-20074004 TCCCTATGTTGAGGGAGGGCTGG - Intergenic
927872002 2:26629615-26629637 TCTCTTTGAGGAAGGAGACTTGG + Intronic
928942032 2:36735871-36735893 TCTCAAGGTTGCAGGAGAGAGGG - Intronic
929120600 2:38480976-38480998 TCCATATGTTGAAGGGGAGAAGG + Intergenic
930157449 2:48119949-48119971 TTTCTCTATTGAAGGAGATTAGG - Intergenic
931641801 2:64387043-64387065 TCTATATGTTGCAGGAGAAAAGG - Intergenic
932088374 2:68782652-68782674 ACTCATTGTAGAAGGAGAGTAGG + Intronic
932651349 2:73561334-73561356 TCCCTGTGTTGAAGGAGTGCTGG + Intronic
933301258 2:80544054-80544076 TCCTTCTCTTGAAGGAGAGTTGG - Intronic
935301376 2:101697057-101697079 TCTCTAGGGTGTGGGAGAGTGGG + Intronic
938168934 2:129057807-129057829 TCTTTATGTGGTTGGAGAGTAGG + Intergenic
938916763 2:135949148-135949170 CCTCTATGTTTGGGGAGAGTGGG + Intronic
939047203 2:137263879-137263901 TCTCTTTGTTCAAGGAGAAATGG - Intronic
939507509 2:143066452-143066474 ACTCTTTGTTGAATGAGAGTGGG - Intergenic
939800284 2:146699586-146699608 TCTCTATGTAGATGGTAAGTTGG - Intergenic
940854317 2:158717882-158717904 CCTCTATGTGGAAGGAGGGAAGG + Intergenic
942141767 2:172984459-172984481 TGTCTAGGTTGAAGGGGAGAGGG - Intronic
943187138 2:184624877-184624899 TCACTTTGTTGAATGGGAGTGGG + Intronic
943701944 2:190996444-190996466 TCTCTGTGTGCAAGCAGAGTTGG - Intronic
943765060 2:191651909-191651931 TCTCTATGTTATAAGAAAGTTGG - Intergenic
945446745 2:209947339-209947361 TCTCTATGTTGCAGGAATATTGG - Intronic
945838679 2:214862515-214862537 TTGCTTTGTTGAAGAAGAGTTGG + Intergenic
946354208 2:219174867-219174889 CCTCTATGATGAAGGGGAGGAGG - Exonic
946917287 2:224537009-224537031 TCTCTATGGTAAAGGATATTTGG - Intronic
947408475 2:229807657-229807679 TGTCTATTTTGTTGGAGAGTGGG - Intronic
948690173 2:239697012-239697034 GCTCTGTGGTGAAGGACAGTTGG - Intergenic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1168911159 20:1448217-1448239 TCCCTATTATCAAGGAGAGTTGG + Intronic
1171972324 20:31572199-31572221 TCTCTGTGTTGAGGAAGAGGAGG + Intronic
1172215050 20:33229694-33229716 ACTCTTGGTTGGAGGAGAGTGGG - Intergenic
1172301062 20:33850774-33850796 TCTCTATTTTAAAGGGGAGGAGG + Intronic
1176983669 21:15411560-15411582 TATCCATGTGGAAGGAGATTGGG + Intergenic
1178677204 21:34641340-34641362 TTTCTATGTTGAGGGAGTGCTGG - Intergenic
1183252643 22:36741215-36741237 TCACTCAGTTGAATGAGAGTTGG + Intergenic
949694251 3:6675762-6675784 TCTCCATATTGATGGTGAGTTGG - Intergenic
950167446 3:10812323-10812345 TTTCTTTGTTGAGGGACAGTGGG - Intergenic
952015743 3:28955188-28955210 TCTATATGTGTAAGGAGATTAGG - Intergenic
953481712 3:43257660-43257682 TCTCCATGTTGAAGGCTAGATGG - Intergenic
954751867 3:52818373-52818395 TCTCGATGTTGAAGTAGTGAGGG - Exonic
961971508 3:130973257-130973279 TATGTATGTTAAAGCAGAGTGGG + Intronic
964691648 3:159456301-159456323 TCTCTATGTTGAGGGAATGATGG + Intronic
966580302 3:181554241-181554263 TCTCTATGTTAATGCATAGTTGG + Intergenic
967763417 3:193250950-193250972 TCTCTCTGTTGAAAGAAACTGGG - Intronic
968554380 4:1239783-1239805 TTCCTATCTTGAAGGAAAGTGGG - Intronic
970140093 4:12972766-12972788 GTTCTATGTTGAAGGGGAGAGGG - Intergenic
972651754 4:41024631-41024653 TCCCTATGTTGAAGGAGGGCTGG - Intronic
973152009 4:46899954-46899976 TTTCCATGTTGAAGGAGGCTTGG - Intronic
974732997 4:65894531-65894553 TATCTAAGTTGTAGGACAGTTGG + Intergenic
974989277 4:69064290-69064312 TCCCTATGTTGAAGGAGTTTTGG - Intronic
975048777 4:69832919-69832941 TCTCTATATTGAGGGAGTGCTGG + Intronic
975389444 4:73799680-73799702 TCTATGTGGGGAAGGAGAGTGGG + Intergenic
975795488 4:78002560-78002582 TCTCTATTTTAAAGAAGAGCAGG + Intergenic
976943813 4:90739369-90739391 TCTCTCTGCTTAAGGAGAGGAGG - Intronic
978647223 4:110950176-110950198 TCCCTATATTAAATGAGAGTTGG + Intergenic
979505010 4:121485569-121485591 GATCTATGTTGAGGGAGGGTGGG + Intergenic
979962960 4:127043205-127043227 TCTCTGTGTTGAAAGACAGTCGG - Intergenic
982640749 4:157956903-157956925 TTTCTATGTTGAAGATCAGTTGG - Intergenic
985869859 5:2545648-2545670 TCTCCCTGTGGAACGAGAGTGGG - Intergenic
988038245 5:25855540-25855562 TCTCTATGTTTAAAGAAAGAAGG + Intergenic
988659943 5:33254932-33254954 TCTCTATTTTGATGAACAGTGGG - Intergenic
989220354 5:38953288-38953310 TCTCTATGTTGAAGAATAGATGG - Intronic
989741316 5:44776057-44776079 TGTGAGTGTTGAAGGAGAGTGGG + Intergenic
991299668 5:65117795-65117817 TTTCTATGTTGAATAAGATTAGG + Intergenic
991497988 5:67246602-67246624 TCTCTATGTAGAATGAAAGTGGG - Intergenic
991938967 5:71831764-71831786 TCTTTATGTTGAAGGAGATCAGG + Intergenic
994278292 5:97866483-97866505 TCTTTAAGATGAAGGAGAGGTGG + Intergenic
994327362 5:98463920-98463942 TCTCTAGGAGGAAGGAGTGTAGG + Intergenic
994933665 5:106222433-106222455 GCTCTATCTTGAAGGAAACTGGG + Intergenic
994982012 5:106887659-106887681 TTTCTATGTTGATTGAGAGAGGG + Intergenic
998877707 5:146617621-146617643 ACTCTTTGTTGAAGGAGCGTAGG - Intronic
999791444 5:154943448-154943470 TGTCTATGTAAAATGAGAGTGGG + Intronic
1000713695 5:164613013-164613035 TTTATTTGTTGAAGGACAGTTGG + Intergenic
1000843722 5:166253350-166253372 CTTCTATGTTGCAGGAGAATGGG + Intergenic
1003213976 6:4091954-4091976 TCGCTATGTTGAGGGAGTGCTGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1003849658 6:10208872-10208894 TCTCTATGTTGAAGGAGAGTGGG - Intronic
1005580175 6:27226534-27226556 CCTCCATGTTGCAGGAGAATTGG + Intergenic
1005939916 6:30553163-30553185 TCTCAGTCTTGAAGAAGAGTCGG - Exonic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1008373045 6:50758276-50758298 TCTAAATATTGAAGGAGAGTAGG - Intronic
1008687463 6:53941514-53941536 TATCTATGTAGAAGGAAAGCAGG + Intronic
1009911975 6:69941393-69941415 TCCATATATTGAAGGAGAGGTGG + Intronic
1011002139 6:82603163-82603185 TTTTTATGTTGAAGGAGATTTGG - Intergenic
1011636926 6:89383101-89383123 TCTATATCTTGAAGGAGGGGTGG + Intronic
1015426466 6:133075227-133075249 TCTGTGTGTTGGAGGTGAGTGGG + Intergenic
1015933833 6:138388546-138388568 TCTCCATGTGGAAGGCTAGTGGG - Intergenic
1016772531 6:147868015-147868037 TCTTTATGTTGCAAGAGGGTTGG + Intergenic
1017091954 6:150767129-150767151 TCTTTATTTTGAGGGAGTGTAGG + Intronic
1018666009 6:166139049-166139071 GTTCTATGTTGAAGAGGAGTGGG - Intergenic
1018838355 6:167501649-167501671 TCACTATGTTGAGGGAGAGAAGG + Intergenic
1024322244 7:48083118-48083140 TCTATATGATGAGTGAGAGTTGG + Intergenic
1024322500 7:48085007-48085029 TCTATATGATGAGTGAGAGTTGG + Intergenic
1024423614 7:49199979-49200001 TCTGTATGTTGAGGGAGTGCTGG - Intergenic
1024663856 7:51526219-51526241 TGTCTTTGTTGAAGATGAGTTGG - Intergenic
1030680601 7:112430120-112430142 TCCCTCTGTGGAATGAGAGTGGG - Intronic
1030813514 7:114005621-114005643 TCTATATGAGGATGGAGAGTAGG + Intronic
1033102234 7:138483925-138483947 CCTCTCTGTGGAAGTAGAGTGGG + Intronic
1033438979 7:141361398-141361420 TCTCTATGTCCAAGCACAGTTGG + Intronic
1033875341 7:145810694-145810716 TCTCTACCCTGAAGGAGAGAAGG + Intergenic
1034217269 7:149417856-149417878 TCACGATGTTAAATGAGAGTGGG + Intergenic
1037100853 8:15043984-15044006 TCTCTGCATTGAAGGAGAGGAGG - Intronic
1037141637 8:15526816-15526838 TCTCAGTGTTGAGGGAGACTAGG + Intronic
1037782222 8:21877730-21877752 TTTCTCTGTTGAAGGAGAGGTGG + Intergenic
1038764324 8:30413396-30413418 TCTCTCTCTGGAAGGAGAGTGGG + Intronic
1041507350 8:58614285-58614307 TCCCTATGTTAAAGGAGTGCTGG - Intronic
1042527144 8:69774863-69774885 TATGTAAGTTGAAAGAGAGTTGG - Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1044197540 8:89395726-89395748 TCTCTATGATGATGCAGAGATGG - Intergenic
1044334314 8:90961015-90961037 TTTCTATGTAAAAGGAGAATTGG - Intronic
1045289546 8:100820908-100820930 TCTCTTTTTTAAAGGTGAGTTGG + Intergenic
1047192807 8:122693666-122693688 TCTCTATGTTCAGGCTGAGTGGG - Intergenic
1047238769 8:123066096-123066118 TCTCTCTCTTGAAATAGAGTGGG + Intronic
1047758774 8:127938791-127938813 TCTCTGTGTGGCAGGCGAGTGGG + Intergenic
1048305075 8:133278468-133278490 TCTCTATGTTGCAGGACGCTGGG - Intronic
1048687705 8:136923183-136923205 TCTCTCTGTTGTCAGAGAGTAGG + Intergenic
1048947982 8:139467962-139467984 TTTCTATTTAGAAGGGGAGTCGG + Intergenic
1049081866 8:140449579-140449601 TCTCTGTGTACAAGGAGTGTTGG - Intronic
1050566922 9:6894694-6894716 TTTCCATGTGGAAGTAGAGTGGG + Intronic
1053781720 9:41616612-41616634 TCCCTATGTTGAGGGAGCGCTGG + Intergenic
1055780316 9:79814040-79814062 TCTCTATGATGAAGGAGGTAGGG + Intergenic
1056975655 9:91250846-91250868 TCTCTAAGTTGAAGGAAACAGGG - Intronic
1058188879 9:101889273-101889295 TCATTCTGTTGAAGGATAGTAGG - Intergenic
1059509525 9:114830994-114831016 TCTCTCTGATGGAGAAGAGTTGG - Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1186324214 X:8461184-8461206 TGTCTTTGTTGAAGTTGAGTTGG - Intergenic
1189724029 X:43950649-43950671 TTTATATGTTGAAGGAGCCTGGG + Intronic
1191723131 X:64251419-64251441 TCTCTGGTTTGAAGGAGAGCTGG + Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1194743082 X:97598419-97598441 TCTCTATTTAGAATGAGACTAGG - Intronic
1194968107 X:100312742-100312764 TCTCTCTATTAAAGAAGAGTTGG - Intronic
1195490677 X:105465809-105465831 TCTCTTTGTTCAAGGACAATAGG + Intronic
1197729746 X:129799320-129799342 CCTCTATTGTGAAGGAGAGGTGG - Intergenic
1198335444 X:135661543-135661565 ACACTATGTTGAAGAGGAGTGGG + Intergenic
1199698444 X:150360253-150360275 TCTATGTGTTGAGGAAGAGTTGG + Intergenic
1200014484 X:153147891-153147913 TCCCCAGGTTGAAGAAGAGTGGG - Intergenic
1200025118 X:153252063-153252085 TCCCCAGGTTGAAGAAGAGTGGG + Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1201439256 Y:13990612-13990634 TGTCTTTGTTGAAGTTGAGTTGG + Intergenic
1201445317 Y:14052096-14052118 TGTCTTTGTTGAAGTTGAGTTGG - Intergenic
1202334090 Y:23788290-23788312 TCTCTATGTTGAAGATGCTTAGG - Intergenic
1202536678 Y:25881769-25881791 TCTCTATGTTGAAGATGCTTAGG + Intergenic