ID: 1003852794

View in Genome Browser
Species Human (GRCh38)
Location 6:10242219-10242241
Sequence GTTTGAGGAGGTGGAGCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003852794_1003852802 20 Left 1003852794 6:10242219-10242241 CCAAAGGCTCCACCTCCTCAAAC No data
Right 1003852802 6:10242262-10242284 TTTCAACATACAAATTGGAGGGG No data
1003852794_1003852799 15 Left 1003852794 6:10242219-10242241 CCAAAGGCTCCACCTCCTCAAAC No data
Right 1003852799 6:10242257-10242279 TAAAATTTCAACATACAAATTGG No data
1003852794_1003852803 23 Left 1003852794 6:10242219-10242241 CCAAAGGCTCCACCTCCTCAAAC No data
Right 1003852803 6:10242265-10242287 CAACATACAAATTGGAGGGGAGG No data
1003852794_1003852800 18 Left 1003852794 6:10242219-10242241 CCAAAGGCTCCACCTCCTCAAAC No data
Right 1003852800 6:10242260-10242282 AATTTCAACATACAAATTGGAGG No data
1003852794_1003852801 19 Left 1003852794 6:10242219-10242241 CCAAAGGCTCCACCTCCTCAAAC No data
Right 1003852801 6:10242261-10242283 ATTTCAACATACAAATTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003852794 Original CRISPR GTTTGAGGAGGTGGAGCCTT TGG (reversed) Intergenic