ID: 1003852803

View in Genome Browser
Species Human (GRCh38)
Location 6:10242265-10242287
Sequence CAACATACAAATTGGAGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003852797_1003852803 8 Left 1003852797 6:10242234-10242256 CCTCAAACCATCATGTTGAGAGT No data
Right 1003852803 6:10242265-10242287 CAACATACAAATTGGAGGGGAGG No data
1003852792_1003852803 27 Left 1003852792 6:10242215-10242237 CCTCCCAAAGGCTCCACCTCCTC No data
Right 1003852803 6:10242265-10242287 CAACATACAAATTGGAGGGGAGG No data
1003852796_1003852803 11 Left 1003852796 6:10242231-10242253 CCTCCTCAAACCATCATGTTGAG No data
Right 1003852803 6:10242265-10242287 CAACATACAAATTGGAGGGGAGG No data
1003852793_1003852803 24 Left 1003852793 6:10242218-10242240 CCCAAAGGCTCCACCTCCTCAAA No data
Right 1003852803 6:10242265-10242287 CAACATACAAATTGGAGGGGAGG No data
1003852794_1003852803 23 Left 1003852794 6:10242219-10242241 CCAAAGGCTCCACCTCCTCAAAC No data
Right 1003852803 6:10242265-10242287 CAACATACAAATTGGAGGGGAGG No data
1003852795_1003852803 14 Left 1003852795 6:10242228-10242250 CCACCTCCTCAAACCATCATGTT No data
Right 1003852803 6:10242265-10242287 CAACATACAAATTGGAGGGGAGG No data
1003852798_1003852803 1 Left 1003852798 6:10242241-10242263 CCATCATGTTGAGAGTTAAAATT No data
Right 1003852803 6:10242265-10242287 CAACATACAAATTGGAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003852803 Original CRISPR CAACATACAAATTGGAGGGG AGG Intergenic