ID: 1003854687

View in Genome Browser
Species Human (GRCh38)
Location 6:10261162-10261184
Sequence GCTGCTGCTCTGGCACATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003854687_1003854689 1 Left 1003854687 6:10261162-10261184 CCTGGATGTGCCAGAGCAGCAGC No data
Right 1003854689 6:10261186-10261208 TGAAAGAGTTATTTGCTTCATGG No data
1003854687_1003854690 11 Left 1003854687 6:10261162-10261184 CCTGGATGTGCCAGAGCAGCAGC No data
Right 1003854690 6:10261196-10261218 ATTTGCTTCATGGAGACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003854687 Original CRISPR GCTGCTGCTCTGGCACATCC AGG (reversed) Intergenic
No off target data available for this crispr