ID: 1003860598

View in Genome Browser
Species Human (GRCh38)
Location 6:10319026-10319048
Sequence AAATGTCCACAGCTGGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003860594_1003860598 -9 Left 1003860594 6:10319012-10319034 CCTGAGGAGGAGGAAAATGTCCA No data
Right 1003860598 6:10319026-10319048 AAATGTCCACAGCTGGGGCATGG No data
1003860592_1003860598 -5 Left 1003860592 6:10319008-10319030 CCTCCCTGAGGAGGAGGAAAATG No data
Right 1003860598 6:10319026-10319048 AAATGTCCACAGCTGGGGCATGG No data
1003860593_1003860598 -8 Left 1003860593 6:10319011-10319033 CCCTGAGGAGGAGGAAAATGTCC No data
Right 1003860598 6:10319026-10319048 AAATGTCCACAGCTGGGGCATGG No data
1003860591_1003860598 -4 Left 1003860591 6:10319007-10319029 CCCTCCCTGAGGAGGAGGAAAAT No data
Right 1003860598 6:10319026-10319048 AAATGTCCACAGCTGGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003860598 Original CRISPR AAATGTCCACAGCTGGGGCA TGG Intergenic
No off target data available for this crispr