ID: 1003860648

View in Genome Browser
Species Human (GRCh38)
Location 6:10319325-10319347
Sequence ACTTCCTCCCATCCCCACGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003860648_1003860656 2 Left 1003860648 6:10319325-10319347 CCACCGTGGGGATGGGAGGAAGT No data
Right 1003860656 6:10319350-10319372 AGGGTTTTCCATGGGGATAGAGG No data
1003860648_1003860660 10 Left 1003860648 6:10319325-10319347 CCACCGTGGGGATGGGAGGAAGT No data
Right 1003860660 6:10319358-10319380 CCATGGGGATAGAGGGATGTGGG No data
1003860648_1003860663 25 Left 1003860648 6:10319325-10319347 CCACCGTGGGGATGGGAGGAAGT No data
Right 1003860663 6:10319373-10319395 GATGTGGGCAGGTTTTCCGTGGG No data
1003860648_1003860655 -5 Left 1003860648 6:10319325-10319347 CCACCGTGGGGATGGGAGGAAGT No data
Right 1003860655 6:10319343-10319365 GAAGTGGAGGGTTTTCCATGGGG No data
1003860648_1003860653 -7 Left 1003860648 6:10319325-10319347 CCACCGTGGGGATGGGAGGAAGT No data
Right 1003860653 6:10319341-10319363 AGGAAGTGGAGGGTTTTCCATGG No data
1003860648_1003860662 24 Left 1003860648 6:10319325-10319347 CCACCGTGGGGATGGGAGGAAGT No data
Right 1003860662 6:10319372-10319394 GGATGTGGGCAGGTTTTCCGTGG No data
1003860648_1003860657 3 Left 1003860648 6:10319325-10319347 CCACCGTGGGGATGGGAGGAAGT No data
Right 1003860657 6:10319351-10319373 GGGTTTTCCATGGGGATAGAGGG No data
1003860648_1003860661 14 Left 1003860648 6:10319325-10319347 CCACCGTGGGGATGGGAGGAAGT No data
Right 1003860661 6:10319362-10319384 GGGGATAGAGGGATGTGGGCAGG No data
1003860648_1003860658 9 Left 1003860648 6:10319325-10319347 CCACCGTGGGGATGGGAGGAAGT No data
Right 1003860658 6:10319357-10319379 TCCATGGGGATAGAGGGATGTGG No data
1003860648_1003860664 26 Left 1003860648 6:10319325-10319347 CCACCGTGGGGATGGGAGGAAGT No data
Right 1003860664 6:10319374-10319396 ATGTGGGCAGGTTTTCCGTGGGG No data
1003860648_1003860654 -6 Left 1003860648 6:10319325-10319347 CCACCGTGGGGATGGGAGGAAGT No data
Right 1003860654 6:10319342-10319364 GGAAGTGGAGGGTTTTCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003860648 Original CRISPR ACTTCCTCCCATCCCCACGG TGG (reversed) Intergenic
No off target data available for this crispr