ID: 1003860650

View in Genome Browser
Species Human (GRCh38)
Location 6:10319328-10319350
Sequence TCCACTTCCTCCCATCCCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003860650_1003860654 -9 Left 1003860650 6:10319328-10319350 CCGTGGGGATGGGAGGAAGTGGA No data
Right 1003860654 6:10319342-10319364 GGAAGTGGAGGGTTTTCCATGGG No data
1003860650_1003860657 0 Left 1003860650 6:10319328-10319350 CCGTGGGGATGGGAGGAAGTGGA No data
Right 1003860657 6:10319351-10319373 GGGTTTTCCATGGGGATAGAGGG No data
1003860650_1003860662 21 Left 1003860650 6:10319328-10319350 CCGTGGGGATGGGAGGAAGTGGA No data
Right 1003860662 6:10319372-10319394 GGATGTGGGCAGGTTTTCCGTGG No data
1003860650_1003860656 -1 Left 1003860650 6:10319328-10319350 CCGTGGGGATGGGAGGAAGTGGA No data
Right 1003860656 6:10319350-10319372 AGGGTTTTCCATGGGGATAGAGG No data
1003860650_1003860660 7 Left 1003860650 6:10319328-10319350 CCGTGGGGATGGGAGGAAGTGGA No data
Right 1003860660 6:10319358-10319380 CCATGGGGATAGAGGGATGTGGG No data
1003860650_1003860658 6 Left 1003860650 6:10319328-10319350 CCGTGGGGATGGGAGGAAGTGGA No data
Right 1003860658 6:10319357-10319379 TCCATGGGGATAGAGGGATGTGG No data
1003860650_1003860661 11 Left 1003860650 6:10319328-10319350 CCGTGGGGATGGGAGGAAGTGGA No data
Right 1003860661 6:10319362-10319384 GGGGATAGAGGGATGTGGGCAGG No data
1003860650_1003860665 30 Left 1003860650 6:10319328-10319350 CCGTGGGGATGGGAGGAAGTGGA No data
Right 1003860665 6:10319381-10319403 CAGGTTTTCCGTGGGGATAGAGG No data
1003860650_1003860664 23 Left 1003860650 6:10319328-10319350 CCGTGGGGATGGGAGGAAGTGGA No data
Right 1003860664 6:10319374-10319396 ATGTGGGCAGGTTTTCCGTGGGG No data
1003860650_1003860663 22 Left 1003860650 6:10319328-10319350 CCGTGGGGATGGGAGGAAGTGGA No data
Right 1003860663 6:10319373-10319395 GATGTGGGCAGGTTTTCCGTGGG No data
1003860650_1003860653 -10 Left 1003860650 6:10319328-10319350 CCGTGGGGATGGGAGGAAGTGGA No data
Right 1003860653 6:10319341-10319363 AGGAAGTGGAGGGTTTTCCATGG No data
1003860650_1003860655 -8 Left 1003860650 6:10319328-10319350 CCGTGGGGATGGGAGGAAGTGGA No data
Right 1003860655 6:10319343-10319365 GAAGTGGAGGGTTTTCCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003860650 Original CRISPR TCCACTTCCTCCCATCCCCA CGG (reversed) Intergenic
No off target data available for this crispr