ID: 1003860655

View in Genome Browser
Species Human (GRCh38)
Location 6:10319343-10319365
Sequence GAAGTGGAGGGTTTTCCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003860650_1003860655 -8 Left 1003860650 6:10319328-10319350 CCGTGGGGATGGGAGGAAGTGGA No data
Right 1003860655 6:10319343-10319365 GAAGTGGAGGGTTTTCCATGGGG No data
1003860641_1003860655 10 Left 1003860641 6:10319310-10319332 CCTGGACGGGAGTGGCCACCGTG No data
Right 1003860655 6:10319343-10319365 GAAGTGGAGGGTTTTCCATGGGG No data
1003860648_1003860655 -5 Left 1003860648 6:10319325-10319347 CCACCGTGGGGATGGGAGGAAGT No data
Right 1003860655 6:10319343-10319365 GAAGTGGAGGGTTTTCCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003860655 Original CRISPR GAAGTGGAGGGTTTTCCATG GGG Intergenic