ID: 1003860659

View in Genome Browser
Species Human (GRCh38)
Location 6:10319358-10319380
Sequence CCCACATCCCTCTATCCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003860659_1003860677 30 Left 1003860659 6:10319358-10319380 CCATGGGGATAGAGGGATGTGGG No data
Right 1003860677 6:10319411-10319433 GGGTTTTCCGTGGGGATGGAGGG No data
1003860659_1003860669 8 Left 1003860659 6:10319358-10319380 CCATGGGGATAGAGGGATGTGGG No data
Right 1003860669 6:10319389-10319411 CCGTGGGGATAGAGGGACGTGGG No data
1003860659_1003860663 -8 Left 1003860659 6:10319358-10319380 CCATGGGGATAGAGGGATGTGGG No data
Right 1003860663 6:10319373-10319395 GATGTGGGCAGGTTTTCCGTGGG No data
1003860659_1003860673 21 Left 1003860659 6:10319358-10319380 CCATGGGGATAGAGGGATGTGGG No data
Right 1003860673 6:10319402-10319424 GGGACGTGGGGGTTTTCCGTGGG No data
1003860659_1003860664 -7 Left 1003860659 6:10319358-10319380 CCATGGGGATAGAGGGATGTGGG No data
Right 1003860664 6:10319374-10319396 ATGTGGGCAGGTTTTCCGTGGGG No data
1003860659_1003860671 10 Left 1003860659 6:10319358-10319380 CCATGGGGATAGAGGGATGTGGG No data
Right 1003860671 6:10319391-10319413 GTGGGGATAGAGGGACGTGGGGG No data
1003860659_1003860676 29 Left 1003860659 6:10319358-10319380 CCATGGGGATAGAGGGATGTGGG No data
Right 1003860676 6:10319410-10319432 GGGGTTTTCCGTGGGGATGGAGG No data
1003860659_1003860666 1 Left 1003860659 6:10319358-10319380 CCATGGGGATAGAGGGATGTGGG No data
Right 1003860666 6:10319382-10319404 AGGTTTTCCGTGGGGATAGAGGG No data
1003860659_1003860667 7 Left 1003860659 6:10319358-10319380 CCATGGGGATAGAGGGATGTGGG No data
Right 1003860667 6:10319388-10319410 TCCGTGGGGATAGAGGGACGTGG No data
1003860659_1003860672 20 Left 1003860659 6:10319358-10319380 CCATGGGGATAGAGGGATGTGGG No data
Right 1003860672 6:10319401-10319423 AGGGACGTGGGGGTTTTCCGTGG No data
1003860659_1003860674 22 Left 1003860659 6:10319358-10319380 CCATGGGGATAGAGGGATGTGGG No data
Right 1003860674 6:10319403-10319425 GGACGTGGGGGTTTTCCGTGGGG No data
1003860659_1003860662 -9 Left 1003860659 6:10319358-10319380 CCATGGGGATAGAGGGATGTGGG No data
Right 1003860662 6:10319372-10319394 GGATGTGGGCAGGTTTTCCGTGG No data
1003860659_1003860670 9 Left 1003860659 6:10319358-10319380 CCATGGGGATAGAGGGATGTGGG No data
Right 1003860670 6:10319390-10319412 CGTGGGGATAGAGGGACGTGGGG No data
1003860659_1003860665 0 Left 1003860659 6:10319358-10319380 CCATGGGGATAGAGGGATGTGGG No data
Right 1003860665 6:10319381-10319403 CAGGTTTTCCGTGGGGATAGAGG No data
1003860659_1003860675 26 Left 1003860659 6:10319358-10319380 CCATGGGGATAGAGGGATGTGGG No data
Right 1003860675 6:10319407-10319429 GTGGGGGTTTTCCGTGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003860659 Original CRISPR CCCACATCCCTCTATCCCCA TGG (reversed) Intergenic
No off target data available for this crispr