ID: 1003860660

View in Genome Browser
Species Human (GRCh38)
Location 6:10319358-10319380
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003860650_1003860660 7 Left 1003860650 6:10319328-10319350 CCGTGGGGATGGGAGGAAGTGGA No data
Right 1003860660 6:10319358-10319380 CCATGGGGATAGAGGGATGTGGG No data
1003860648_1003860660 10 Left 1003860648 6:10319325-10319347 CCACCGTGGGGATGGGAGGAAGT No data
Right 1003860660 6:10319358-10319380 CCATGGGGATAGAGGGATGTGGG No data
1003860641_1003860660 25 Left 1003860641 6:10319310-10319332 CCTGGACGGGAGTGGCCACCGTG No data
Right 1003860660 6:10319358-10319380 CCATGGGGATAGAGGGATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003860660 Original CRISPR CCATGGGGATAGAGGGATGT GGG Intergenic