ID: 1003860664

View in Genome Browser
Species Human (GRCh38)
Location 6:10319374-10319396
Sequence ATGTGGGCAGGTTTTCCGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003860648_1003860664 26 Left 1003860648 6:10319325-10319347 CCACCGTGGGGATGGGAGGAAGT No data
Right 1003860664 6:10319374-10319396 ATGTGGGCAGGTTTTCCGTGGGG No data
1003860650_1003860664 23 Left 1003860650 6:10319328-10319350 CCGTGGGGATGGGAGGAAGTGGA No data
Right 1003860664 6:10319374-10319396 ATGTGGGCAGGTTTTCCGTGGGG No data
1003860659_1003860664 -7 Left 1003860659 6:10319358-10319380 CCATGGGGATAGAGGGATGTGGG No data
Right 1003860664 6:10319374-10319396 ATGTGGGCAGGTTTTCCGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003860664 Original CRISPR ATGTGGGCAGGTTTTCCGTG GGG Intergenic
No off target data available for this crispr