ID: 1003860665

View in Genome Browser
Species Human (GRCh38)
Location 6:10319381-10319403
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003860659_1003860665 0 Left 1003860659 6:10319358-10319380 CCATGGGGATAGAGGGATGTGGG No data
Right 1003860665 6:10319381-10319403 CAGGTTTTCCGTGGGGATAGAGG No data
1003860650_1003860665 30 Left 1003860650 6:10319328-10319350 CCGTGGGGATGGGAGGAAGTGGA No data
Right 1003860665 6:10319381-10319403 CAGGTTTTCCGTGGGGATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003860665 Original CRISPR CAGGTTTTCCGTGGGGATAG AGG Intergenic