ID: 1003860668

View in Genome Browser
Species Human (GRCh38)
Location 6:10319389-10319411
Sequence CCCACGTCCCTCTATCCCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003860668_1003860684 21 Left 1003860668 6:10319389-10319411 CCGTGGGGATAGAGGGACGTGGG No data
Right 1003860684 6:10319433-10319455 GATGTGGGCAGGTTTTCGGTGGG No data
1003860668_1003860683 20 Left 1003860668 6:10319389-10319411 CCGTGGGGATAGAGGGACGTGGG No data
Right 1003860683 6:10319432-10319454 GGATGTGGGCAGGTTTTCGGTGG No data
1003860668_1003860676 -2 Left 1003860668 6:10319389-10319411 CCGTGGGGATAGAGGGACGTGGG No data
Right 1003860676 6:10319410-10319432 GGGGTTTTCCGTGGGGATGGAGG No data
1003860668_1003860688 30 Left 1003860668 6:10319389-10319411 CCGTGGGGATAGAGGGACGTGGG No data
Right 1003860688 6:10319442-10319464 AGGTTTTCGGTGGGGATGGCGGG No data
1003860668_1003860681 10 Left 1003860668 6:10319389-10319411 CCGTGGGGATAGAGGGACGTGGG No data
Right 1003860681 6:10319422-10319444 GGGGATGGAGGGATGTGGGCAGG No data
1003860668_1003860685 22 Left 1003860668 6:10319389-10319411 CCGTGGGGATAGAGGGACGTGGG No data
Right 1003860685 6:10319434-10319456 ATGTGGGCAGGTTTTCGGTGGGG No data
1003860668_1003860682 17 Left 1003860668 6:10319389-10319411 CCGTGGGGATAGAGGGACGTGGG No data
Right 1003860682 6:10319429-10319451 GAGGGATGTGGGCAGGTTTTCGG No data
1003860668_1003860678 5 Left 1003860668 6:10319389-10319411 CCGTGGGGATAGAGGGACGTGGG No data
Right 1003860678 6:10319417-10319439 TCCGTGGGGATGGAGGGATGTGG No data
1003860668_1003860677 -1 Left 1003860668 6:10319389-10319411 CCGTGGGGATAGAGGGACGTGGG No data
Right 1003860677 6:10319411-10319433 GGGTTTTCCGTGGGGATGGAGGG No data
1003860668_1003860686 26 Left 1003860668 6:10319389-10319411 CCGTGGGGATAGAGGGACGTGGG No data
Right 1003860686 6:10319438-10319460 GGGCAGGTTTTCGGTGGGGATGG No data
1003860668_1003860674 -9 Left 1003860668 6:10319389-10319411 CCGTGGGGATAGAGGGACGTGGG No data
Right 1003860674 6:10319403-10319425 GGACGTGGGGGTTTTCCGTGGGG No data
1003860668_1003860680 6 Left 1003860668 6:10319389-10319411 CCGTGGGGATAGAGGGACGTGGG No data
Right 1003860680 6:10319418-10319440 CCGTGGGGATGGAGGGATGTGGG No data
1003860668_1003860675 -5 Left 1003860668 6:10319389-10319411 CCGTGGGGATAGAGGGACGTGGG No data
Right 1003860675 6:10319407-10319429 GTGGGGGTTTTCCGTGGGGATGG No data
1003860668_1003860687 29 Left 1003860668 6:10319389-10319411 CCGTGGGGATAGAGGGACGTGGG No data
Right 1003860687 6:10319441-10319463 CAGGTTTTCGGTGGGGATGGCGG No data
1003860668_1003860673 -10 Left 1003860668 6:10319389-10319411 CCGTGGGGATAGAGGGACGTGGG No data
Right 1003860673 6:10319402-10319424 GGGACGTGGGGGTTTTCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003860668 Original CRISPR CCCACGTCCCTCTATCCCCA CGG (reversed) Intergenic
No off target data available for this crispr