ID: 1003860671

View in Genome Browser
Species Human (GRCh38)
Location 6:10319391-10319413
Sequence GTGGGGATAGAGGGACGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003860659_1003860671 10 Left 1003860659 6:10319358-10319380 CCATGGGGATAGAGGGATGTGGG No data
Right 1003860671 6:10319391-10319413 GTGGGGATAGAGGGACGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003860671 Original CRISPR GTGGGGATAGAGGGACGTGG GGG Intergenic
No off target data available for this crispr