ID: 1003860673

View in Genome Browser
Species Human (GRCh38)
Location 6:10319402-10319424
Sequence GGGACGTGGGGGTTTTCCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003860668_1003860673 -10 Left 1003860668 6:10319389-10319411 CCGTGGGGATAGAGGGACGTGGG No data
Right 1003860673 6:10319402-10319424 GGGACGTGGGGGTTTTCCGTGGG No data
1003860659_1003860673 21 Left 1003860659 6:10319358-10319380 CCATGGGGATAGAGGGATGTGGG No data
Right 1003860673 6:10319402-10319424 GGGACGTGGGGGTTTTCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003860673 Original CRISPR GGGACGTGGGGGTTTTCCGT GGG Intergenic
No off target data available for this crispr