ID: 1003860741

View in Genome Browser
Species Human (GRCh38)
Location 6:10319629-10319651
Sequence CCGTAGGGATGGTGGGACGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003860731_1003860741 7 Left 1003860731 6:10319599-10319621 CCGTGGAGATGACGGGACGTGGG No data
Right 1003860741 6:10319629-10319651 CCGTAGGGATGGTGGGACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003860741 Original CRISPR CCGTAGGGATGGTGGGACGT GGG Intergenic
No off target data available for this crispr