ID: 1003860777

View in Genome Browser
Species Human (GRCh38)
Location 6:10319750-10319772
Sequence CCGTGGGGATGGAGGGACGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003860766_1003860777 7 Left 1003860766 6:10319720-10319742 CCGTGGGGATGGAGGGATGTGGC No data
Right 1003860777 6:10319750-10319772 CCGTGGGGATGGAGGGACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003860777 Original CRISPR CCGTGGGGATGGAGGGACGT GGG Intergenic
No off target data available for this crispr