ID: 1003860787

View in Genome Browser
Species Human (GRCh38)
Location 6:10319780-10319802
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003860776_1003860787 7 Left 1003860776 6:10319750-10319772 CCGTGGGGATGGAGGGACGTGGG No data
Right 1003860787 6:10319780-10319802 CCGTGGGGATGGAGGGACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003860787 Original CRISPR CCGTGGGGATGGAGGGACGT GGG Intergenic
No off target data available for this crispr