ID: 1003868349

View in Genome Browser
Species Human (GRCh38)
Location 6:10382872-10382894
Sequence AGCAAGAAAGGGGGCGCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003868336_1003868349 1 Left 1003868336 6:10382848-10382870 CCACGCGTGTCTTCCCCGCAGCC No data
Right 1003868349 6:10382872-10382894 AGCAAGAAAGGGGGCGCCGGGGG No data
1003868329_1003868349 27 Left 1003868329 6:10382822-10382844 CCCCATGCGTAGGACACTATAGG No data
Right 1003868349 6:10382872-10382894 AGCAAGAAAGGGGGCGCCGGGGG No data
1003868335_1003868349 2 Left 1003868335 6:10382847-10382869 CCCACGCGTGTCTTCCCCGCAGC No data
Right 1003868349 6:10382872-10382894 AGCAAGAAAGGGGGCGCCGGGGG No data
1003868331_1003868349 26 Left 1003868331 6:10382823-10382845 CCCATGCGTAGGACACTATAGGG No data
Right 1003868349 6:10382872-10382894 AGCAAGAAAGGGGGCGCCGGGGG No data
1003868333_1003868349 25 Left 1003868333 6:10382824-10382846 CCATGCGTAGGACACTATAGGGG No data
Right 1003868349 6:10382872-10382894 AGCAAGAAAGGGGGCGCCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003868349 Original CRISPR AGCAAGAAAGGGGGCGCCGG GGG Intergenic