ID: 1003870522

View in Genome Browser
Species Human (GRCh38)
Location 6:10399098-10399120
Sequence ATTTTGAATAGGAAGGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 605
Summary {0: 1, 1: 0, 2: 1, 3: 53, 4: 550}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003870522 Original CRISPR ATTTTGAATAGGAAGGCTGA TGG (reversed) Intronic
900037272 1:425652-425674 GTATTGAATAGGAATGATGAAGG + Intergenic
900058901 1:661393-661415 GTATTGAATAGGAATGATGAAGG + Intergenic
902327400 1:15710636-15710658 ATTTTGAAAAAGAATGTTGAGGG + Intronic
903391740 1:22969091-22969113 TTTTTGAATAGGAGGGCTTTTGG + Intergenic
904713228 1:32447434-32447456 ATTTTTGATAGGAAGGCTAAAGG + Intergenic
906767016 1:48442895-48442917 ATTTTTGATAGGAAGGCTATGGG - Intronic
906797650 1:48710706-48710728 ATGTTGAACAGGAAGGCTCCTGG - Intronic
907505862 1:54917839-54917861 ATTTTTAATAGGAAGTCTACAGG + Intergenic
907718300 1:56948327-56948349 ATATTGAATAGTAATACTGAAGG + Intronic
908052279 1:60246413-60246435 ATTTTGAGTGGGGAGCCTGAAGG + Intergenic
908300875 1:62760080-62760102 ATTTTTGATAGGAAGGCTATGGG - Intergenic
908373810 1:63512525-63512547 ATTTTGAATAACAGGACTGAGGG + Intronic
908524114 1:64970995-64971017 CTTTTGCAGAGGAAGACTGATGG - Intergenic
908754230 1:67453347-67453369 ATTTTGAAAAAGAAGGGTGATGG + Intergenic
908870889 1:68610235-68610257 ATGTTGAATAGGAGTGGTGAAGG + Intergenic
908877313 1:68692117-68692139 ATATAGAAAAGGAAGGCTGCTGG - Intergenic
908891726 1:68856732-68856754 ATGTTGAATAGGAGTGGTGAGGG + Intergenic
908937299 1:69391483-69391505 ATGGTGAATAGGAATGGTGAGGG + Intergenic
910396986 1:86803351-86803373 ATTTTTGATAGGAAGGCTACGGG + Intergenic
910577993 1:88788860-88788882 TTTTATAACAGGAAGGCTGAGGG - Intronic
910590704 1:88925977-88925999 ATTTTTGATAGGAAGGCTACTGG - Intergenic
912368107 1:109151406-109151428 ATTGTGAAGAGGAGGGCTGAGGG - Intronic
914339521 1:146747581-146747603 ATTAAAAATCGGAAGGCTGAAGG - Intergenic
914803601 1:150976911-150976933 CTTTGGAATTAGAAGGCTGAAGG - Intergenic
915724982 1:158011077-158011099 AGCTTGCATAGGAAGGCTGTCGG - Intronic
915816081 1:158966818-158966840 CTATTGAATAGGAATGGTGAGGG - Intronic
916084124 1:161256159-161256181 ATTTTTGATAGGAAGGCTATGGG - Intergenic
916945036 1:169717962-169717984 ATTTGGAATAGGAAAGGTCATGG + Intronic
917227783 1:172802435-172802457 ATTTTTGATAGGAAGGCTATGGG - Intergenic
918787861 1:188788185-188788207 ATTTTGAATAGGAGTGGTAAGGG - Intergenic
919304876 1:195819447-195819469 ATGTTGAATAGGAGTGGTGAGGG + Intergenic
920064930 1:203262061-203262083 ATGTTGAATAGGAGTGGTGAGGG - Intronic
920645584 1:207801278-207801300 ATGTTGAAGATCAAGGCTGAGGG - Intergenic
920899764 1:210096573-210096595 ATCATAAATAGGAATGCTGATGG - Intronic
921038315 1:211404327-211404349 ATGTTGAATAGGAGTGGTGAGGG + Intergenic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
922568865 1:226620167-226620189 ATGTTGAATAGGAGTGGTGAGGG + Intergenic
922754764 1:228089534-228089556 ATTTTAAAAATGTAGGCTGAGGG - Intronic
922952473 1:229570528-229570550 ATTTCCAAGAGAAAGGCTGAAGG + Intergenic
1063224662 10:4004486-4004508 CTGTTGAATGAGAAGGCTGAAGG + Intergenic
1063415153 10:5867180-5867202 ATTTTTGATAGGAAGGCTATGGG - Intronic
1063819409 10:9817817-9817839 ATGTTGAATAGGAGTGGTGAGGG + Intergenic
1064080377 10:12303362-12303384 ATTAGGAATGGGGAGGCTGATGG - Intergenic
1064702121 10:18032684-18032706 ATGTTGAATAGGAGTGGTGAGGG + Intronic
1064942784 10:20753703-20753725 ATGTTGAATAGGAGCGGTGAGGG + Intergenic
1065080611 10:22125945-22125967 ATGTTGAATAGGAGTGGTGAGGG + Intergenic
1065247524 10:23773994-23774016 ATGTTGAATAGGAGTGGTGAGGG + Intronic
1065396935 10:25249346-25249368 ATGTTGAATAGGAGTGGTGAGGG + Intronic
1065466576 10:26030464-26030486 AGTGTGAATATGAATGCTGAGGG - Intronic
1065810372 10:29437734-29437756 ATTTTGATTAGGAGGGCTACCGG + Intergenic
1066139016 10:32484531-32484553 ATGTTGAATAGGAGTGGTGAGGG + Intronic
1067313198 10:45134712-45134734 ATTTTGCAAGGGAAGTCTGAAGG + Intergenic
1068240871 10:54299554-54299576 ATTTTTGATAGGAAGGCTATGGG - Intronic
1069356605 10:67593793-67593815 ATGTTGAATAGGAGTGATGAGGG + Intronic
1069364757 10:67685565-67685587 ATTTTAGATAGGAAGGCTATGGG + Intronic
1070062106 10:72993985-72994007 ATGTTGAATAGGAGTGGTGAGGG - Intergenic
1070065041 10:73025569-73025591 ATGTTGAATAGGAGTGGTGAGGG - Intronic
1071101750 10:82046603-82046625 ATGTTGAATAGGAGTGGTGAGGG + Intronic
1071117045 10:82233696-82233718 ATCTTGAAAGGGAAGACTGAGGG - Intronic
1071283376 10:84123279-84123301 ATTTTTGATAGGAAGGCTATGGG + Intergenic
1071327204 10:84529328-84529350 ATTTTTGATAGGAAGGCTACGGG + Intergenic
1071784868 10:88887816-88887838 ATTGTTAAAAGGAAGGCTGTTGG - Intronic
1071835194 10:89411139-89411161 ATTTTTGATAGGAAGGCTACTGG - Intronic
1072391973 10:94996734-94996756 ATTTTTGATAGGAAGGCTATAGG + Intergenic
1072472171 10:95723063-95723085 ATTTTTGATAGGAAGGCTGCGGG + Intronic
1072545872 10:96438061-96438083 ATTATGAAAAAGAAGACTGAAGG - Intronic
1073764073 10:106662798-106662820 ATTCTGTAAAGGAAAGCTGAGGG - Intronic
1074379217 10:112965030-112965052 AATGTGAATGGGAAGGCTTAAGG + Intronic
1075146787 10:119889236-119889258 ATTTTTGATAGGAAGGCTATGGG - Intronic
1076215270 10:128688218-128688240 ATTTTCAATAGGACGTCTGTTGG - Intergenic
1076322571 10:129594232-129594254 CTTTTGCATAAGAAGTCTGAGGG + Intronic
1076390231 10:130094833-130094855 ATGTTGAATAGGAGTGGTGAGGG - Intergenic
1077398301 11:2337975-2337997 TTTTTGATTAGGAAGGCTATGGG - Intergenic
1078231397 11:9446405-9446427 ATCTTGACTAGATAGGCTGAAGG + Exonic
1078935806 11:15948922-15948944 ATTTTCAATATCAAGGCAGATGG - Intergenic
1079255066 11:18820715-18820737 ATTTTTGATAGGAAGGCTACTGG + Intergenic
1079656986 11:22996800-22996822 ATTGTTGATAGGAAGGCTGTGGG + Intergenic
1079934008 11:26595980-26596002 ATTTTTGATAGGAAGGCTATGGG + Intronic
1080130529 11:28789354-28789376 ATGTTGAATAGGAGCGGTGAGGG + Intergenic
1080906231 11:36548231-36548253 ATGTTGAATAGGAGTGGTGAGGG - Intronic
1081033647 11:38115447-38115469 ATTTTTGATAGGAAGGCTACGGG - Intergenic
1081146343 11:39565545-39565567 ATTTTTGATAGGAAGGCTATGGG - Intergenic
1081241065 11:40707245-40707267 ATGTTGAATAGGAGTGGTGAGGG + Intronic
1081425664 11:42923912-42923934 ATGTTGAATAGGAATGGTGATGG + Intergenic
1081517820 11:43850676-43850698 ATTCAGAAGAGGAAGGCTTATGG - Intronic
1082084205 11:48035849-48035871 ATCTTGAAGAGGAAGACAGAGGG - Intronic
1082951415 11:58820053-58820075 ATGTTGAATAGGAGTGGTGAGGG - Intergenic
1082963497 11:58941582-58941604 ATTTTTAATAGGATGGCCAAAGG + Intronic
1085035266 11:73296201-73296223 AAGTTCACTAGGAAGGCTGAAGG + Intronic
1085340475 11:75728005-75728027 ATTCTGAACAGGAAGGGTGGCGG + Exonic
1086052022 11:82603415-82603437 GTTTCGAATAGCAATGCTGAGGG - Intergenic
1086069463 11:82784456-82784478 AAGTTGAATAGGAATGGTGAGGG + Intergenic
1086264622 11:84983029-84983051 ATATTGAATAAAAAGGATGAGGG - Intronic
1086317870 11:85612241-85612263 ATTTTTGATAGGAAGGCTATGGG - Intronic
1086565384 11:88220232-88220254 ATGTTGAATAGGAGTGGTGAGGG + Intergenic
1086567610 11:88244568-88244590 ATGTTGAATAGGAGTGGTGAGGG - Intergenic
1086901550 11:92373125-92373147 ATTGTGACTAGGAAGGACGATGG - Intronic
1086987253 11:93263727-93263749 ATTTTTGATAGGAAGGCTACGGG - Intergenic
1087233972 11:95697717-95697739 AGGTTGAACAGGAAGGCTGCAGG + Intergenic
1087596509 11:100260902-100260924 ATTTTTAATAGAAATGGTGATGG - Intronic
1087640236 11:100748727-100748749 TTTTTGATTAGGAAGGCTACGGG + Intronic
1087719503 11:101646144-101646166 ATGTTGAATAGAAATGGTGAAGG - Intronic
1087881641 11:103422793-103422815 ATGTTGAATAGGAGTGGTGAGGG - Intronic
1088228429 11:107647001-107647023 ATTTTGAATAGGAAATTAGATGG - Intronic
1088306495 11:108415113-108415135 ATGTTGAATAGAAAAGGTGAGGG - Intronic
1090148047 11:124348927-124348949 ATATTGAATAGCAGCGCTGAAGG - Intergenic
1090183027 11:124717680-124717702 CTTTGGAATAGTAAAGCTGAGGG + Intergenic
1091455448 12:604087-604109 ATCTTGAAAAAGAAGGCTGGAGG - Intronic
1091814688 12:3428473-3428495 ATTTTTGATAGGAAGGCTACAGG + Intronic
1092399457 12:8161804-8161826 ATTTTTTATAGGAAGGCTATGGG - Intronic
1093115263 12:15202023-15202045 ATGTTGATTAGGAAGGAAGAAGG - Intronic
1093348368 12:18068192-18068214 ATTTTTGATAGGAAGGCTACTGG - Intergenic
1093356550 12:18174249-18174271 TTTTTGATTAGGAAGGCTACGGG - Intronic
1093388424 12:18587163-18587185 ATGTTGAATAGGAGTGATGAGGG - Intronic
1093413273 12:18892257-18892279 ATGTTGAATAGGAGTGGTGAGGG + Intergenic
1093693487 12:22134092-22134114 ATGTTGAATAGGAGTGATGAGGG - Intronic
1095118889 12:38389644-38389666 ATATTGAAAAGAAAGGCTAAGGG + Intergenic
1095283709 12:40385607-40385629 ATTTTTGATAGGAAGGCTAAGGG - Intergenic
1095608183 12:44095823-44095845 ATGTTGAATAGGAGTGGTGAGGG - Intronic
1096028844 12:48393365-48393387 ATGTTTAATAGGAATGGTGAGGG + Intergenic
1096034322 12:48451448-48451470 ATATTGAATAGGAGTGGTGAGGG - Intergenic
1096831009 12:54314293-54314315 AATTAGAATAAGATGGCTGAAGG - Intronic
1097317973 12:58193238-58193260 ATATTGAATAGAAAAGGTGAGGG + Intergenic
1098783814 12:74723232-74723254 CTTTTGAATAGGAAGAATGTAGG + Intergenic
1099031205 12:77527854-77527876 ATGTTGAATAGGAGTGGTGAGGG - Intergenic
1099070911 12:78044964-78044986 ATGTTGAATAGGAGTGGTGATGG + Intronic
1099239768 12:80125072-80125094 ATATTGAATAGGAGTGGTGAGGG + Intergenic
1099260133 12:80369079-80369101 TTTTTGAAAAGAAAGGGTGAAGG - Intronic
1099536291 12:83849162-83849184 ATACTGAATAGGAAGCCTGATGG + Intergenic
1099695998 12:86020226-86020248 ATGTTGAATAGGAGTGTTGAGGG + Intronic
1100040802 12:90314624-90314646 ATTTTGAAGAGGGAGGTTAACGG - Intergenic
1100583468 12:95957537-95957559 TTTCTAAATAGGAAGGCTCATGG + Intronic
1100874721 12:98950015-98950037 GGTTTGAATTGAAAGGCTGAAGG + Intronic
1101142151 12:101807392-101807414 ATTTTGAATAAGAATGGTGATGG - Intronic
1101277822 12:103221834-103221856 AAACTGAATAGCAAGGCTGAGGG + Intergenic
1103157205 12:118696106-118696128 ATTTTGAATGTGGAGGATGAAGG - Intergenic
1103262601 12:119601337-119601359 ATTCTGATCAGGAATGCTGAAGG + Intronic
1104183904 12:126409914-126409936 ATGATGTATAGCAAGGCTGATGG - Intergenic
1104851757 12:131879132-131879154 ATTTTTGATAGGAAGGCTACTGG + Intergenic
1106255874 13:28021611-28021633 ATTTTGAATAGACAGACTGGAGG + Intronic
1106290058 13:28352644-28352666 AATGTCAATAGGAGGGCTGAGGG - Intronic
1108324207 13:49314015-49314037 GTTTGGAACAGGAAGGCTCATGG + Intronic
1108349391 13:49577195-49577217 ATTTAGAACTGGAAGGCTGAAGG + Intronic
1108515850 13:51201773-51201795 ATTTTTGATAGGAAGGCTATGGG + Intergenic
1108815286 13:54283361-54283383 ATGTTGAATAGGAGTGGTGAGGG + Intergenic
1108849068 13:54705947-54705969 ATTTTTGATAGGAAGGCTACAGG - Intergenic
1109383278 13:61594437-61594459 ATTTTGATTAGTCAGGCTAAAGG + Intergenic
1109606923 13:64708095-64708117 ATTTTTGATAGGAAGGCTACTGG + Intergenic
1109774784 13:67026520-67026542 ATGTTGAATAGGAGTGGTGAGGG - Intronic
1109941294 13:69369434-69369456 ATGTTGAATAGGAGTGGTGAGGG - Intergenic
1110085747 13:71377189-71377211 ATTTTGAATAAGAAGCCACAGGG + Intergenic
1110606581 13:77439857-77439879 ATGTTGAATAGGAGTGGTGAGGG + Intergenic
1110643210 13:77850767-77850789 ATGTTGAATAGAAATGGTGAGGG + Intergenic
1110643618 13:77855248-77855270 AAATTGAAAAGGAAGGGTGATGG + Intergenic
1111429347 13:88131956-88131978 ATTTTGAATAGGAATGGGAATGG - Intergenic
1111892352 13:94099671-94099693 TTTTTTTATTGGAAGGCTGATGG + Intronic
1112111545 13:96305146-96305168 ATTAGGAATAGGAAGCCTAATGG + Intronic
1112126658 13:96475965-96475987 AGTCTGAATATGAGGGCTGAGGG - Intronic
1112592851 13:100779891-100779913 ATGTTGAATAGGAGTGGTGAGGG + Intergenic
1112645297 13:101324810-101324832 ATGTTGAATAGGAGTGGTGAGGG + Intronic
1112778964 13:102876858-102876880 ATTTTCAATTTGAAGGCTGAAGG - Intergenic
1114236301 14:20827122-20827144 TTTTTGATTAGGAAGGCTACGGG + Intergenic
1114805204 14:25827512-25827534 ATTTTGAGTAGCAAGAATGAAGG - Intergenic
1115211057 14:30967549-30967571 ATTTTTGATAGGAAGGCTACGGG - Intronic
1116725670 14:48558824-48558846 ATTTTTGATAGGAAGGCTATGGG - Intergenic
1116931931 14:50699449-50699471 ATGTTGAATAGGAGGGGTGAAGG + Intergenic
1117025779 14:51618615-51618637 AGGTTGAATGTGAAGGCTGAGGG + Intronic
1117179748 14:53180158-53180180 TTTTTGATTAGGAAGGCTATGGG + Intergenic
1117812135 14:59558472-59558494 ATTTTGAATATGAAGGCAATAGG + Intronic
1117836951 14:59817651-59817673 ATTTTGAAGAGCAAGTCTGCTGG + Intronic
1118263950 14:64275751-64275773 ATTTTGAGTAGAAAGTCTAAAGG - Intronic
1120058832 14:79957657-79957679 ATGTTGAATAGGAGTGGTGAGGG - Intergenic
1120388146 14:83871411-83871433 ATTTTAAATGGGAAGGAAGAAGG + Intergenic
1120561211 14:85995338-85995360 ATTTTTATTAGGAAGTCTGATGG - Intergenic
1120563092 14:86020324-86020346 AATTACAATAGTAAGGCTGAAGG + Intergenic
1122382490 14:101318581-101318603 ATTTTTGATAGGAAGGCTACAGG - Intergenic
1123668567 15:22629868-22629890 AACTAGGATAGGAAGGCTGAGGG + Intergenic
1124064676 15:26330685-26330707 ATGTTCAATAGGAATGGTGAGGG - Intergenic
1124524545 15:30436338-30436360 AACTAGGATAGGAAGGCTGAGGG + Intergenic
1124534120 15:30529892-30529914 AACTAGGATAGGAAGGCTGAGGG - Intergenic
1124764527 15:32477718-32477740 AACTAGGATAGGAAGGCTGAGGG + Intergenic
1124774108 15:32571372-32571394 AACTAGGATAGGAAGGCTGAGGG - Intergenic
1125133097 15:36307517-36307539 GTTTTCAATGGGAAGGTTGAGGG + Intergenic
1127286178 15:57535659-57535681 AGTTTGAAGAGGCAGACTGAGGG + Intronic
1127309109 15:57736545-57736567 ATTTAAAATAGAAAGGATGAAGG - Intronic
1127539782 15:59925737-59925759 ATTTTGACTAGGCAGGCTAATGG + Intergenic
1128362889 15:66975125-66975147 ATTTTTGATAGGAAGGCTACAGG + Intergenic
1130359493 15:83169221-83169243 ATGTTGAATAGGAGTGGTGAAGG - Intronic
1131861959 15:96663284-96663306 ATGTTGAATAGGGAGGCTCTGGG + Intergenic
1132401424 15:101509330-101509352 ATTTTCAATAAGAATGTTGAAGG + Intronic
1132444554 15:101901606-101901628 GTATTGAATAGGAATGATGAAGG - Intergenic
1133568299 16:7016290-7016312 AGTTTGAATAGTATGGCAGAAGG - Intronic
1133960620 16:10489726-10489748 ATTTTTGATAGGAAGGCTATGGG - Intergenic
1134176367 16:12009944-12009966 ATTATGAACAGGAATGCTAACGG + Intronic
1135224532 16:20644155-20644177 ATTTTTGATAGAAAGGCTGCTGG - Intronic
1135271675 16:21074945-21074967 ATTTTGAATAGTAAGGGTGTAGG - Intronic
1135339183 16:21631708-21631730 ATTTTTGATAGGAAGGCTATGGG + Intronic
1135774489 16:25244488-25244510 TTTATGAATAGGAAGACTCAAGG + Intronic
1139994762 16:70969827-70969849 ATTAAAAATCGGAAGGCTGAAGG + Intronic
1140589547 16:76335504-76335526 AGTTTGGAAAGGAAGGATGAGGG + Intronic
1140807933 16:78550815-78550837 AATTGGAATATAAAGGCTGAGGG + Intronic
1142018839 16:87767184-87767206 ATTTTAAATGGGAAGGTGGAAGG - Intergenic
1142523476 17:521059-521081 ATTTTGAAGAGTAGGGATGAGGG - Intronic
1142893174 17:2958148-2958170 ATCTTGCATAGGGAGGCAGAGGG + Intronic
1144432304 17:15204956-15204978 ATGTTGAATAGGAGTGGTGAGGG - Intergenic
1146211630 17:30947829-30947851 ATTTGGAATTGGGAGGCTAAAGG - Intronic
1149274351 17:55016987-55017009 ATTTTTGATAGGAAGGCTAAGGG + Intronic
1150154601 17:62841858-62841880 ATTTTGAATAAGAAGAGTAATGG + Intergenic
1150383273 17:64737671-64737693 GTTTTACATAGGAAGGGTGAGGG - Intergenic
1151209190 17:72531401-72531423 ATTTTTAAAGGGGAGGCTGAGGG - Intergenic
1152268319 17:79309232-79309254 ATTTTGCACAGGAAGGAGGAAGG + Intronic
1153090704 18:1339306-1339328 ATGTTGAATAGGAGTGGTGAGGG - Intergenic
1153438268 18:5089410-5089432 GTTTTTAATAGGAAGGCTATGGG - Intergenic
1153734601 18:8052159-8052181 ATTTTGAATAGCAGGGCTCTAGG + Intronic
1154142145 18:11833655-11833677 TTTCTGTATAGGAAGTCTGAGGG - Intronic
1155194838 18:23463956-23463978 ATTTTGAATAGTGTTGCTGAAGG + Exonic
1155746391 18:29360835-29360857 ATTTTTGATAGGAAGGCTACGGG + Intergenic
1156063197 18:33106513-33106535 ATTTTGAATAGGAACACTTATGG + Intronic
1157029059 18:43882459-43882481 AGTGAGAAGAGGAAGGCTGATGG - Intergenic
1157031216 18:43910660-43910682 ATGTTGAATAGGAGTGGTGAGGG + Intergenic
1157396969 18:47350262-47350284 ATGTTGAATAGGAGTGGTGAGGG + Intergenic
1158200206 18:54931085-54931107 ATTTTGAATTTGTAGGGTGAGGG + Intronic
1160629526 18:80236458-80236480 ATGTTGAATAGGAGTGGTGAGGG - Intronic
1162108368 19:8385182-8385204 ATTTTTGATAGGAAGGCTACAGG - Intronic
1163370795 19:16900140-16900162 ATTTTGTACAGGAAGGAAGAGGG - Intronic
1163867270 19:19784588-19784610 ATTTTTGATAGGAAGGCTACGGG + Intergenic
1163927706 19:20361535-20361557 ATTTTTGATAGGAAGGCTACAGG - Intergenic
1164121739 19:22271957-22271979 ATTTTTGATAGGAAGGCTACAGG + Intergenic
1164173372 19:22746876-22746898 ATTTTTGATAGGAAGGCTATGGG - Intergenic
1164902218 19:31938065-31938087 ATTTTCAATGGGGAGGATGAGGG - Intergenic
1164992572 19:32695040-32695062 ATTTTTGATAGGAAGGCTACAGG + Intronic
1165673673 19:37702531-37702553 TTTTTGTATAGTAAGTCTGATGG - Intronic
1166266605 19:41688427-41688449 GCTTTGAGTAGCAAGGCTGATGG + Intronic
1167867062 19:52336979-52337001 ATTTTGAAAAAGAAGCATGAGGG + Intronic
924974312 2:158970-158992 ATTTTTAATAGGAAGGCTACGGG + Intergenic
925260655 2:2525555-2525577 ATTTTAATTAGGGAAGCTGATGG - Intergenic
925949415 2:8896933-8896955 ATTTTTGATAGGAAGGCTACGGG + Intronic
926019308 2:9481475-9481497 AATCTGGATAGGAATGCTGAGGG + Intronic
928347926 2:30517952-30517974 ATTTTTGATAGGAAGGCTACGGG - Intronic
928476257 2:31630535-31630557 ATTTTTGATAGGAAGGCTACTGG - Intergenic
928576596 2:32661802-32661824 ATGTTGAATAGGAATGGTGAGGG + Intronic
930375164 2:50556113-50556135 ATTTTGCATTGGTAGGCTTACGG + Intronic
930873725 2:56191580-56191602 GTTTTGAAATGGAAGGTTGAAGG + Intronic
931540788 2:63326992-63327014 ATTTTTGATAGGAAGGCTATGGG - Intronic
931892027 2:66683691-66683713 ATTTTGAATGGCAAGGCTATTGG - Intergenic
932562027 2:72881550-72881572 ATTTTGAAGACGAAGGCAAAAGG - Intergenic
932967717 2:76497091-76497113 ATTTTGGTTTGGAAGGCTGTAGG - Intergenic
934672198 2:96221650-96221672 ATTTTTGATAGGAAGGCTACTGG + Intergenic
934867575 2:97826882-97826904 ATTTTTGATAGGAAGGCTACTGG - Intronic
935721611 2:105984699-105984721 ATTTTTGATAGGAAGGCTGCAGG + Intergenic
935748571 2:106210772-106210794 ATTTTTTATAGGAAGGCTACTGG - Intergenic
936262813 2:110976691-110976713 AATTTGAACAGGAAGTCAGAGGG + Intronic
936716650 2:115194433-115194455 ATTTTTGATAGGAAGGCTACGGG + Intronic
937411553 2:121681276-121681298 ATTTTTGATAGGAAGGCTACTGG + Intergenic
937822561 2:126327314-126327336 ATTTTGAGTAGCAAGGATGATGG + Intergenic
938805734 2:134805692-134805714 ATTTTTGATAGGAAGGCTATGGG + Intergenic
939132387 2:138252462-138252484 AGTTTGAATACGATGGCTGTAGG + Intergenic
939157308 2:138540777-138540799 ATGTTGAATAGGAGTGGTGAGGG + Intronic
939469133 2:142597462-142597484 ATGTTGAATAGAAAGTCTAAAGG - Intergenic
939493864 2:142905778-142905800 ATTTTTGATAGGAAGGCTACAGG + Intronic
939564769 2:143774034-143774056 ATATTTAAGAGGAAGGCTGCTGG - Intergenic
939824664 2:146999907-146999929 ATTTTTGATAGGAAGGCTACGGG - Intergenic
940230129 2:151442315-151442337 ATTTGGAAGAGCAAGGCGGAGGG - Intronic
940574729 2:155487839-155487861 ATTTTGAATAGGATGCATAAAGG + Intergenic
941243735 2:163071665-163071687 ATTTTTGATAGGAAGGCTATGGG - Intergenic
942604842 2:177679781-177679803 ATTTTGAAAATGGAAGCTGAAGG + Intronic
942816287 2:180057873-180057895 ATTTTTGATAGGAAGGCTACTGG - Intergenic
942830440 2:180232886-180232908 ATTTTTGATAGGAAGGCTATGGG - Intergenic
943056853 2:182992428-182992450 ATTTTAAACGGGAATGCTGATGG - Intronic
943102853 2:183508962-183508984 ATTTTTGATAGGAAGGCTATGGG + Intergenic
943134208 2:183891139-183891161 ATTTTTCATAGGAAGGCTATGGG - Intergenic
943521765 2:188960600-188960622 ATGTTGAATAGAAATGGTGAAGG + Intergenic
943902227 2:193455141-193455163 ATTTTTGATAGGAAGGCTAGGGG - Intergenic
945347470 2:208735324-208735346 ATGTTGAATAGGAACGGTGAAGG + Intronic
945600675 2:211859729-211859751 ATATTGGATATGAAAGCTGAAGG + Intronic
945720083 2:213408286-213408308 ATTTTTTATAGGAAGGCTACAGG - Intronic
946010129 2:216557876-216557898 ATTTTGCAAAGGAAATCTGATGG - Intronic
946570133 2:221015373-221015395 CCTTTGAATTGGAAGGCTGGTGG + Intergenic
946816075 2:223579885-223579907 ACTTTGAGTAGCAAAGCTGAGGG - Intergenic
946945051 2:224812521-224812543 ATGTTGAATAGGAGTGGTGAGGG + Intronic
948200524 2:236127022-236127044 ATTCTGAACAGGAAAGGTGAGGG - Exonic
949015168 2:241704948-241704970 ATTTTGATTGGAAAGGGTGATGG - Intronic
1168943038 20:1729659-1729681 AGTTTGGATAGGAAGGCTACAGG + Intergenic
1170059250 20:12242309-12242331 GTTTTAAATAGGAAGGTAGATGG - Intergenic
1170506227 20:17028392-17028414 ATTATGAACAGTATGGCTGAAGG + Intergenic
1171261818 20:23740825-23740847 ATTTTTGATAGGAAGGCTAAGGG - Intergenic
1171270954 20:23816705-23816727 ATTTTTGATAGGAAGGCTACAGG - Intergenic
1171288924 20:23968851-23968873 TTTTTGAATAGGAGGGCTGAAGG + Intergenic
1173352063 20:42254272-42254294 TTTTTGAGTAGCAAGGCTCATGG - Intronic
1174694908 20:52547353-52547375 ATGTTGAATAGGAATGGTGAGGG - Intergenic
1176344089 21:5725089-5725111 ATCTTGAATAGGAGTGCTGAGGG + Intergenic
1176360394 21:5991054-5991076 ATCTTGAATAGGAGTGGTGATGG + Intergenic
1176500738 21:7599367-7599389 ATCTTGAATAGGAGTGCTGAGGG - Intergenic
1176538410 21:8123158-8123180 ATCTTGAATAGGAGTGCTGAGGG + Intergenic
1177682741 21:24393984-24394006 ATTTTGAATAGCAAGGCTTTAGG - Intergenic
1178109553 21:29356658-29356680 ATTTTTGATAGGAAGGCTATGGG + Intronic
1178836899 21:36105929-36105951 ATTTTTGATAGGAAGGCTACGGG - Intergenic
1179032174 21:37730217-37730239 ATTTTGCATATGAAGACTTAAGG - Intronic
1179056199 21:37937393-37937415 ATTTTGAAAAGAAAGGGTGATGG + Intergenic
1179531876 21:42025129-42025151 AGTTTGAATAGGAAGGCCATGGG + Intergenic
1179763124 21:43547496-43547518 ATCTTGAATAGGAGTGGTGATGG - Intronic
1182515697 22:30857675-30857697 ATTTTGTAGATGAAGACTGAAGG + Intronic
1184064655 22:42110982-42111004 ATTTTTGATAGGAAGGCTACGGG + Intergenic
1184426987 22:44415725-44415747 ATTTTAAATAAAAAGGTTGAAGG - Intergenic
1203243358 22_KI270733v1_random:39514-39536 ATCTCGAATAGGAGTGCTGAGGG + Intergenic
949611396 3:5707316-5707338 ATTTTTGATAGGAAGGCTACGGG + Intergenic
950061901 3:10078661-10078683 GCTTTAAATAGGAAGTCTGAAGG + Intronic
950594801 3:13970364-13970386 ATATTTGATAGGAAGGCTTAGGG + Intronic
950703301 3:14765335-14765357 CTTTAGATTTGGAAGGCTGATGG + Intronic
951020958 3:17780442-17780464 ATTTTTGATAGGAAGGCTATGGG - Intronic
951239799 3:20274509-20274531 ATTTTTGATAGGAAGGCTATAGG - Intergenic
951611735 3:24497275-24497297 ATTTTGAACAGGACCTCTGAGGG + Intergenic
951611898 3:24498848-24498870 GTTTTGTAAATGAAGGCTGATGG - Intergenic
952554849 3:34520335-34520357 ATTTTTGATAGGAAGGCTACAGG + Intergenic
952922488 3:38295470-38295492 ATTTTTGATAGGAAGGCTATGGG + Intronic
953827134 3:46263415-46263437 ATTATGAATAAGAATGCTGATGG + Intronic
954096721 3:48334485-48334507 ATTTTTGATAGGAAGGCTATGGG + Intergenic
954185032 3:48910434-48910456 ATTTGGAAGAGGAAAGCTCATGG + Intergenic
954517640 3:51192950-51192972 ATATTGAATAGGAATGGTGAAGG + Intronic
955488546 3:59459565-59459587 ATATTGAATAGCAAGGATTAAGG - Intergenic
957005003 3:74934715-74934737 ATGTTGAATAGGAGTGGTGAGGG + Intergenic
957815659 3:85293895-85293917 ATGTTGAATAGGAGTGGTGAGGG - Intronic
958255126 3:91316664-91316686 ATGTTGAATAGGAGTGGTGAGGG + Intergenic
958442331 3:94171091-94171113 ATTTTGAAAGGGAAAGATGAGGG + Intergenic
958501526 3:94916092-94916114 ATTTTGTATAGAAAGGCTATTGG - Intergenic
958630068 3:96672884-96672906 ATTTTTGATAGGAAGGCTACAGG + Intergenic
958662988 3:97095491-97095513 ATTTTGAAAAGGAAGGTGGGGGG - Intronic
958706639 3:97664427-97664449 ATGTTGAATAGGAGTGGTGAGGG - Intronic
959385104 3:105694469-105694491 ATATTTAATAGGTAGACTGATGG + Intronic
959418003 3:106100629-106100651 ATATTGAATGGGAAGCCAGAAGG - Intergenic
959627688 3:108471271-108471293 ACTTTGAATAGCAAGGCTTTGGG - Intronic
961744172 3:129053104-129053126 ATTTTGTAAGGGAAGTCTGATGG - Intergenic
962645050 3:137430345-137430367 AATTAGAATAGGAAGTCAGAGGG + Intergenic
962656338 3:137547742-137547764 ATGTTGAATAGGAGTGGTGAGGG - Intergenic
963021580 3:140877166-140877188 ATTTTTGATAGGAAGGCTACGGG - Intergenic
963697194 3:148576525-148576547 ATTTTTGATGGGAAGGCTGCGGG - Intergenic
964053527 3:152424035-152424057 ATGTTGAATAGGAGTGGTGAGGG - Intronic
964190787 3:153998715-153998737 ATGTTGAATAGGAGTGGTGAGGG - Intergenic
964922834 3:161918719-161918741 ATGTTGAATAGGATTGGTGAGGG + Intergenic
964972452 3:162578541-162578563 ATTTTTGATAGGAAGGCTATAGG - Intergenic
965139662 3:164817235-164817257 ATTTTTGATAGGAAGGCTATGGG - Intergenic
965798007 3:172461577-172461599 ATTTTGAAGAGGAAGGTAGGGGG - Intergenic
966234074 3:177681378-177681400 ATTTTGACAAGGAAAGCTGTTGG + Intergenic
966711122 3:182973936-182973958 ATTTTGACTAGTAATTCTGAGGG - Intronic
967584122 3:191191555-191191577 ATTTTGGATAGGAAGGCTATGGG - Intergenic
968178335 3:196570037-196570059 ATTTTGTATATGAAGGCGGGCGG - Intronic
968354086 3:198088160-198088182 ATTTTGAATCTGGAGGATGATGG + Intergenic
969896179 4:10307061-10307083 TTTTTGCAAAGGATGGCTGAGGG + Intergenic
970155044 4:13133223-13133245 ATGTTGAATAGGAGTGGTGAGGG + Intergenic
970555589 4:17228492-17228514 ATGTTGAATAGGAGTGGTGAGGG + Intergenic
970875322 4:20862383-20862405 ATCTACAATAGGAATGCTGAGGG + Intronic
971578905 4:28308780-28308802 ATTTTTGATAGGAAGGCTATGGG - Intergenic
972087076 4:35231344-35231366 AATGTGAATAGGAATGGTGAAGG + Intergenic
972118840 4:35675212-35675234 ATTTTGAATAAGAAAAATGAAGG + Intergenic
972651297 4:41020232-41020254 ATTTTTGATAGGAAGGCTATGGG - Intronic
972781567 4:42291150-42291172 ATTTTTGATAGGAAGGCTATGGG + Intergenic
973047415 4:45551901-45551923 ATTTTAAATATGAAGGCAGCTGG - Intergenic
973064736 4:45774519-45774541 ATGTTGAATAGGAGTGGTGAGGG + Intergenic
973132428 4:46664189-46664211 ATGTTGAATAGGAGTGGTGAGGG + Intergenic
973747296 4:53976454-53976476 ACTTTGAGTAGCAAGGCTGTAGG + Intronic
974269960 4:59637719-59637741 ATATTGAATAGGAGGGGTGAGGG - Intergenic
974520208 4:62973050-62973072 ATTTTTGATAGGAAGGCTATGGG - Intergenic
975205481 4:71639933-71639955 ATTTTTTATAGGAAGGCTACGGG - Intergenic
975400150 4:73927856-73927878 ATGTTGAATAGGAGTGGTGAGGG - Intergenic
975860266 4:78669611-78669633 GAATTGAAGAGGAAGGCTGATGG + Intergenic
976297868 4:83489562-83489584 ATTTTAAATAGGAGGGTTAATGG + Intronic
977043746 4:92044472-92044494 ATTTTTTATAGGAAGGGTGCAGG + Intergenic
977203506 4:94144500-94144522 ATGTTGAATAGGAGTGGTGACGG + Intergenic
977479918 4:97562476-97562498 ATGTTGAATAGGAGTGGTGAGGG + Intronic
977640634 4:99354642-99354664 ATTTTTGATAGGAAGGCTACAGG - Intergenic
977647521 4:99430677-99430699 ATTTTCATTAGTAAGGCAGAGGG - Intronic
977656404 4:99526034-99526056 ATGTTGAATAGAAATGATGAGGG + Intronic
978353573 4:107845866-107845888 ATGTTGAATAGGAAAGCTATAGG + Intronic
978659848 4:111112246-111112268 GTTTTGGAGAGGAAAGCTGAGGG - Intergenic
978906247 4:114009189-114009211 ATATTGAATAGGAGTGGTGAGGG + Intergenic
978909256 4:114046001-114046023 ATTTTTGATAGGAAGGCTACCGG - Intergenic
979005281 4:115287090-115287112 ATATTGAATAGGAGTGGTGAAGG + Intergenic
979012685 4:115391362-115391384 ATGTTGAATAGGAATGATGAGGG - Intergenic
979048621 4:115901602-115901624 ATGTTGAATAGGAGTGGTGAGGG - Intergenic
979141798 4:117184694-117184716 ATGTTGAATAGGAGTGGTGAGGG - Intergenic
979598377 4:122559150-122559172 AATTGGAAAGGGAAGGCTGAAGG + Intergenic
980395516 4:132208788-132208810 ATGTTGAATAGGAGTGGTGAGGG - Intergenic
980439054 4:132817304-132817326 ATTTTTGATAGGAAGGCTGGAGG + Intergenic
981848567 4:149199810-149199832 ATAGAGACTAGGAAGGCTGAGGG - Intergenic
982289291 4:153763858-153763880 ATGTGGAATAGGATGGCAGAGGG + Intergenic
982437138 4:155392797-155392819 ATATTGAAGAGGAAGGCGGCAGG + Intergenic
982701586 4:158663775-158663797 ATTTTTGATAGGAAGGCTATGGG - Intergenic
982752165 4:159175520-159175542 AGTTTTAATAGGAGTGCTGATGG + Intronic
982865576 4:160506074-160506096 ATGTTGAATAGGAGTGGTGAGGG - Intergenic
982877491 4:160666286-160666308 ATTTTTGATAGGAAGGCTACTGG - Intergenic
983048818 4:163019807-163019829 ATGTTGAATAGGAGTGGTGAGGG + Intergenic
983593782 4:169442788-169442810 TTTTAGAAAAGGAAGGCAGAAGG + Intronic
983667202 4:170195424-170195446 ATTTTTGATAGGAAGGCTACTGG + Intergenic
983685208 4:170400414-170400436 ATTTAGAATTTGGAGGCTGAGGG + Intergenic
983762859 4:171434743-171434765 CTTCTAAATAGGAAGGCTGAGGG + Intergenic
984076018 4:175180876-175180898 ATGTTGAATAGGAGTGATGAAGG + Intergenic
984451045 4:179902178-179902200 ATGTTGTATAGGATTGCTGAAGG + Intergenic
984457241 4:179985889-179985911 ATGTTGAATAGGAGTGGTGAGGG + Intergenic
984485289 4:180360398-180360420 ATGTTGAATAGGAGTGGTGAGGG + Intergenic
984578702 4:181483779-181483801 CTTTTGAAAGGGAAGGCTGAAGG - Intergenic
984688677 4:182700471-182700493 ATGTTAAATACGAAGGCTGCTGG - Intronic
985955758 5:3264858-3264880 ATTTTTAATGGGAAAGCTAATGG + Intergenic
987168888 5:15231965-15231987 ATTTTTAACAGGAAGTCTGCAGG - Intergenic
987223297 5:15813164-15813186 ATGTTGAATAGGAGTGGTGAGGG + Intronic
987581156 5:19794393-19794415 ATTTTGGAGAGCAAGACTGATGG - Intronic
988358221 5:30203436-30203458 ATTTTTGATAGGAAGGCTATGGG - Intergenic
988457296 5:31397609-31397631 ATTTTTGATAGGAAGGCTACGGG + Intergenic
988706611 5:33732188-33732210 ATTTTGAATGAGAAGGGAGATGG - Intronic
988874217 5:35425990-35426012 ATTTTGAACTGGAAAGGTGATGG - Intergenic
989123753 5:38031147-38031169 ATTTTGAATCTGAAGCCTAATGG + Intergenic
989811369 5:45680697-45680719 ATTTTGAAAAGGAAAGATCAAGG - Intronic
990117043 5:52402225-52402247 ATTTTTGATAGGAAGGCTATGGG - Intergenic
990154203 5:52856279-52856301 ATTGTGAATTGTAAGGCAGAAGG - Intronic
990239947 5:53806875-53806897 ATGTTGAATAGGAGTGGTGAGGG - Intergenic
990367557 5:55086332-55086354 ATTTTTGATAGGAAGGCTATGGG + Intergenic
990419358 5:55616368-55616390 ATTTTTGATAGGAAGGCTATGGG - Intergenic
990760814 5:59127511-59127533 ATTTTAAAAAGGCAGGCTCACGG - Intronic
990892055 5:60660513-60660535 ATTTTTGATAGGAAGGCTGTGGG - Intronic
992309919 5:75486450-75486472 ATGTTGAATAGCAATGGTGAAGG - Intronic
992322507 5:75627863-75627885 GTTTTGGACAGGAAGGCTGCTGG - Intronic
992455639 5:76913188-76913210 ATTTTTGATAGGAAGGCTATGGG - Intronic
992658948 5:78939219-78939241 CTTTTTACTAGGAAAGCTGATGG - Intronic
992675065 5:79097929-79097951 ATGTTGAATAGGAGTGGTGAGGG + Intronic
992774733 5:80079557-80079579 ACTTTGTACAGGAGGGCTGATGG + Intronic
993405416 5:87506047-87506069 ATTTTGAATAGCAATGGTCAAGG - Intergenic
993945106 5:94109661-94109683 ATTTGGAATAGCAAGGATGTAGG - Intronic
994020369 5:95016673-95016695 ATTTTGAATATGAGCGCTGCAGG - Intronic
994681964 5:102899227-102899249 ATTTTAAATTGGGTGGCTGATGG + Intronic
995465389 5:112445443-112445465 ATTTTTGATAGGAAGGCTATGGG - Intergenic
995521159 5:113006959-113006981 ATTTTTAATAGGGACGGTGAAGG - Intronic
995546050 5:113232487-113232509 ATTCAGAATAGGAAGGCAAAGGG - Intronic
995664376 5:114524700-114524722 ATGTTGAATAGGAGTGGTGAGGG - Intergenic
995745968 5:115403717-115403739 TTTTTGAATATGAAAACTGAAGG - Intergenic
997802435 5:136878805-136878827 ATGTTGAATAGGAGTGGTGAGGG - Intergenic
998552745 5:143093311-143093333 ATTTTTGATAGGAAGGCTACTGG + Intronic
998938863 5:147259392-147259414 ATTTTTGATAGGAAGGCTACTGG + Intronic
999065276 5:148678892-148678914 TTTTGGACTAGGAAGGCTGCTGG + Intergenic
999798165 5:155007415-155007437 ATTTTTAAAAAGAAGGCTAAGGG + Intergenic
1000648670 5:163787737-163787759 ATGTGGAAGAGGAAGGCAGAAGG - Intergenic
1000790412 5:165599860-165599882 ATTTTTAAAACGAAAGCTGAGGG - Intergenic
1001558642 5:172654735-172654757 ATTTTTGATAGGAAGGCTATGGG + Intronic
1002736549 5:181393214-181393236 GTATTGAATAGGAATGATGAAGG - Intergenic
1002854194 6:1022990-1023012 ATGATGAATAGGAAGGTTGGAGG - Intergenic
1003197012 6:3923925-3923947 ATTTTGAAAAAGAAAGTTGAAGG + Intergenic
1003239448 6:4330774-4330796 ATGTTGAATAGGAGTGGTGAGGG + Intergenic
1003805986 6:9726371-9726393 ATTTTTGATAGGAAGGCTACAGG - Intronic
1003870522 6:10399098-10399120 ATTTTGAATAGGAAGGCTGATGG - Intronic
1003940126 6:11016167-11016189 ATTTTAAAAAGGAAGGGAGAAGG - Intronic
1004236574 6:13879888-13879910 ATTTTTGATAGGAAGGCTAAGGG - Intergenic
1004815970 6:19312114-19312136 ATTTTAAGTGGGAAGACTGAAGG - Intergenic
1005266866 6:24121311-24121333 ATTTTGTAAATGAAGTCTGATGG - Intergenic
1006026622 6:31151061-31151083 AGTTTGACCAGCAAGGCTGAGGG - Exonic
1006217375 6:32455968-32455990 ATCTTGAATAAGAATGGTGAGGG - Intergenic
1006413989 6:33892818-33892840 ATCTTGATTTGGAAGGCTGCGGG - Intergenic
1007642757 6:43355877-43355899 AATTTGGATTTGAAGGCTGAGGG - Exonic
1008365255 6:50671573-50671595 ATTTTAAAAAGCAAGGCAGATGG + Intergenic
1008599004 6:53070913-53070935 ACTTTGAGTAGCAAGGCTGTAGG - Exonic
1008979638 6:57468163-57468185 ATGTTGAATAGGAATGGTGAGGG + Intronic
1009041146 6:58178815-58178837 ACTTTGAGGTGGAAGGCTGAAGG - Intergenic
1009635587 6:66260415-66260437 TTTTTGATTAGGAAGGCTACGGG - Intergenic
1009659175 6:66587897-66587919 ATTTTGAATATGTTAGCTGAAGG + Intergenic
1009701904 6:67195383-67195405 ATTTTGAAGAACAAAGCTGAAGG + Intergenic
1009864504 6:69379913-69379935 ATTCTGAATAATAAAGCTGAAGG - Intronic
1009921255 6:70064567-70064589 ATGTTGAATAGGAGTGGTGAAGG - Intronic
1010075265 6:71790574-71790596 ATTTTTGATAGGAAGGCTACAGG - Intergenic
1010310097 6:74375077-74375099 ATGTTGAATAGGAGTGGTGAGGG + Intergenic
1010366960 6:75062227-75062249 ATTTTGTATATGGAGACTGAAGG - Intergenic
1010670460 6:78680407-78680429 ACTTTGAATAGGAGTGATGAGGG - Intergenic
1010877551 6:81126269-81126291 ATCTTGACTAGGATGGCTAAGGG + Intergenic
1011056271 6:83206777-83206799 ATCTTGAATAGGAGTGGTGAGGG - Intergenic
1011076596 6:83445213-83445235 ATTTTTGATAGGAAGGCTACAGG - Intergenic
1011450054 6:87482972-87482994 ATTTTTGATAGGAAGGCTATGGG + Intronic
1012063435 6:94515669-94515691 ATATTGAATAGGAGTGGTGAGGG - Intergenic
1012250948 6:96980197-96980219 ATGTTGAATAGGAGTGCTGAGGG + Intronic
1012584901 6:100910155-100910177 ATGTTGAATAGGAGTGGTGAGGG + Intergenic
1012589363 6:100960908-100960930 ATTTTTACTAGGATTGCTGAGGG + Intergenic
1013021982 6:106229719-106229741 ATTTTTGATAGGAAGGCTATGGG - Intronic
1013633333 6:112006210-112006232 ATTTTGAATAGGATGTGTGTGGG + Intergenic
1014241663 6:119024821-119024843 GTTTTGAATAAGAAGGGAGAAGG + Intronic
1015036325 6:128659386-128659408 ATATAGAAGAGGAAGGCAGAAGG + Intergenic
1015802451 6:137074249-137074271 ATGTTGAATAGGAGTGGTGAGGG - Intergenic
1016343442 6:143086158-143086180 ATTTTTGATAGGAAGGCTACGGG + Intronic
1018191581 6:161314067-161314089 TTTTTGATTAGGAAGGCTACGGG + Intergenic
1018285189 6:162230126-162230148 ACTTTGAATAGCAAGGTTGTAGG + Intronic
1018499646 6:164392573-164392595 ATTTTGAAAAAGAAGAATGAAGG - Intergenic
1019241647 6:170668743-170668765 GTATTGAATAGGAATGATGAAGG - Intergenic
1020435296 7:8155861-8155883 AGTGTGAAGGGGAAGGCTGAGGG + Intronic
1021182410 7:17522779-17522801 ATTTTGAAAAGGAAGAGTAATGG + Intergenic
1021320303 7:19201765-19201787 AAATTGAATAGGAAGGGTAAGGG - Intergenic
1021356155 7:19655239-19655261 ATTTTTAGTAGGAAGGCTATGGG + Intergenic
1021756287 7:23856236-23856258 ATTTTTGATAGGAAGGCTACAGG + Intergenic
1023077769 7:36500740-36500762 ATTTTTGATAGGAAGGCTATGGG + Intergenic
1024174915 7:46829050-46829072 ATTTTGTTTCAGAAGGCTGAAGG - Intergenic
1025798272 7:64759954-64759976 ATTTTTGATAGGAAGGCTATGGG + Intergenic
1028272297 7:88807365-88807387 ATTTTGTATGGGTAGGGTGATGG + Intronic
1028333777 7:89626568-89626590 TTTTTGATTAGGAAGGCTACGGG - Intergenic
1028587599 7:92467486-92467508 ATTTGGAAGAGGAAGGATGTGGG + Intergenic
1028733996 7:94186082-94186104 ATGTTGAATAGGAATGGTGAGGG + Intergenic
1028753965 7:94413661-94413683 ATATTTAACAGAAAGGCTGATGG - Intronic
1031242475 7:119264573-119264595 ATATTGAATAGAAATGGTGAGGG + Intergenic
1031471230 7:122171763-122171785 ATTTTTGATAGGAAGGCTATGGG - Intergenic
1031732226 7:125313761-125313783 ATTTTTGATAGGAAGGCTATGGG - Intergenic
1031792548 7:126126276-126126298 ATTTTGAATAGAAATGGTGAAGG - Intergenic
1032544308 7:132728891-132728913 ATTTTGAACAGGTAGGTTGAGGG - Intergenic
1032744053 7:134768122-134768144 ACTTCCTATAGGAAGGCTGAGGG + Intronic
1032892102 7:136208413-136208435 ATTTTAAAGAGAAATGCTGAGGG - Intergenic
1032966727 7:137106275-137106297 ATGTTGAATAGGAGTGGTGAGGG - Intergenic
1033017810 7:137689933-137689955 ATTTGCCACAGGAAGGCTGAGGG + Exonic
1033580084 7:142724967-142724989 ATTTTGAAGTAGAAGGATGAAGG + Intergenic
1034251701 7:149697226-149697248 ATGTTGAATAGTAAGAGTGATGG - Intergenic
1034479079 7:151306032-151306054 AGATGTAATAGGAAGGCTGAAGG - Intergenic
1034579454 7:152029881-152029903 ATTTTTGATAGGAAGGCTATGGG + Intronic
1035506469 8:139353-139375 GTATTGAATAGGAATGATGAAGG + Intergenic
1035744260 8:1950355-1950377 ATTTTACATGGGAAAGCTGAGGG - Intronic
1035831428 8:2698711-2698733 ATTTTGCACAGGAAAGCTCATGG - Intergenic
1038318326 8:26507039-26507061 ATATTAAATAGTAAGCCTGAAGG - Exonic
1038870259 8:31486133-31486155 ATGTTGAATAGGAGTGGTGAGGG + Intergenic
1039276396 8:35937660-35937682 ATTTTTGATAGGAAGGCTATGGG - Intergenic
1040693764 8:49971471-49971493 ATGTTGAATAGGAGTGGTGAGGG - Intronic
1040704268 8:50106445-50106467 ATGTTGAATAGGAATAGTGAGGG + Intronic
1040859521 8:51984554-51984576 ATTTTTTCTAGGAAGACTGAGGG + Intergenic
1041152440 8:54949859-54949881 ATATGGCATAGGAAGGCAGATGG + Intergenic
1043613963 8:82102620-82102642 ATTTAGAATAGGAGGGTTGGAGG + Intergenic
1043820479 8:84857154-84857176 ATAATGAAAAGGAAGGCTGGAGG + Intronic
1044101305 8:88143165-88143187 AATCTGAATAGGAAGGGTGGTGG + Intronic
1044184856 8:89239293-89239315 TTTTTGATTAGGAAGGCTATGGG + Intergenic
1044418592 8:91965130-91965152 CTTTAGAATTAGAAGGCTGATGG + Intronic
1044456223 8:92395281-92395303 ATTTTTGATAGGAAGGCTATGGG + Intergenic
1044883952 8:96756156-96756178 AATTTGAAAAGGAAAGCTTAGGG - Intronic
1045668887 8:104524554-104524576 ATAATGAATATGAAGGCTAAGGG + Intronic
1045806785 8:106171570-106171592 ATTCTGAATAGGATAGCTGGGGG - Intergenic
1045845958 8:106636606-106636628 ATTTTAAATAGGAAGGTTTCTGG - Intronic
1046106840 8:109676243-109676265 ATGTTGAATAGGAGTGATGACGG - Intronic
1046706221 8:117455380-117455402 ATGTTGAATAGGAGTGGTGAGGG - Intergenic
1048122356 8:131596075-131596097 ATGTTGAATAGGAGTGGTGAGGG - Intergenic
1050169813 9:2803581-2803603 AGTTTGAATAAGAAGGAAGAAGG - Intronic
1050505088 9:6339962-6339984 ATGTTGAATAGGAGTGGTGAGGG - Intergenic
1050590708 9:7157388-7157410 ATCTTGAATAGGAGTGGTGAGGG + Intergenic
1050692759 9:8246864-8246886 ATTTTAAATAGGAAGGCATTTGG - Intergenic
1050709436 9:8443726-8443748 ATATTGAATATGCAGGCAGAGGG + Intronic
1050735519 9:8758080-8758102 ATTTTGATGAGGTAGGCTGGAGG - Intronic
1050818456 9:9846275-9846297 ATTTTGATTGGGAATGCTGTAGG - Intronic
1050959521 9:11709544-11709566 ATTTTATACAGGAAGACTGATGG - Intergenic
1051096033 9:13466089-13466111 ATTGTGAATGGGTAGGCTGTGGG - Intergenic
1051549105 9:18309293-18309315 ATGTTGAATAGGAGTGGTGAGGG - Intergenic
1051877162 9:21804972-21804994 ATCTTGAAGAGGGAGGCAGAGGG + Intronic
1051935705 9:22440405-22440427 ATTTTTGATAGGAAGGCTACGGG - Intergenic
1052632361 9:31058102-31058124 ATGTTGAATAGGAGTGGTGAGGG + Intergenic
1055687705 9:78795175-78795197 ATGTTGAATAGGAGAGGTGATGG + Intergenic
1055843655 9:80535111-80535133 ATGTTGAATAGGAGTGGTGAGGG - Intergenic
1057419275 9:94897131-94897153 ATTTTGAAGAGTAATGATGAGGG + Intronic
1058403231 9:104641310-104641332 ATGTTGAATAGGAGTGGTGAGGG - Intergenic
1060465524 9:123901381-123901403 ATTTTTAATAGGAGGGTAGAGGG - Intronic
1203459682 Un_GL000220v1:22596-22618 ATCTTGAATAGGAGTGCTGAGGG + Intergenic
1203601839 Un_KI270748v1:17977-17999 GTATTGAATAGGAATGATGAAGG - Intergenic
1185953016 X:4457347-4457369 ATTTTCATTAGGAAGGATGATGG - Intergenic
1186380671 X:9055324-9055346 ATTTAGAGAATGAAGGCTGAGGG + Intronic
1188004935 X:25010746-25010768 ATTTTTAAAAAGAAGGCAGAAGG - Intronic
1188097971 X:26046009-26046031 ATTTTTGATAGGAAGGCTATGGG - Intergenic
1188136948 X:26503244-26503266 ATTTTTGATAGGAAGGCTATGGG - Intergenic
1188253895 X:27935888-27935910 ATTTTAAAGAGGAAATCTGAAGG + Intergenic
1189034360 X:37480396-37480418 ATTTTTGATAGGAAGGCTACGGG - Intronic
1189549758 X:42080688-42080710 ATTTTTAAGAGGCAGGCTCATGG + Intergenic
1190270037 X:48855399-48855421 ATTTTTGATAGGAAGGCTACAGG - Intergenic
1190922348 X:54866339-54866361 ATGTTGAATAGGAGTGGTGAGGG + Intergenic
1191020569 X:55855917-55855939 ATGTTGAATAGGAGTGATGAGGG + Intergenic
1191163637 X:57363599-57363621 ATGTTGAATAGGAGTGATGAGGG + Intronic
1191657131 X:63610607-63610629 ATTTTGAATAGGAGTGGTGAGGG - Intergenic
1192482328 X:71496281-71496303 ATTTTTGATAGGAAGGCTACGGG + Intronic
1192689525 X:73347870-73347892 ATGTTGAATAGGAGTGGTGAAGG + Intergenic
1192717288 X:73657653-73657675 ATGTTGAATAGGAATGGTGAGGG + Intronic
1192832009 X:74760422-74760444 ATGTTGAATAGGAACGGTGAGGG + Intronic
1192880770 X:75281299-75281321 ATGTTGAAGAGGAATGGTGAGGG + Intronic
1193172163 X:78348920-78348942 ATTTTTGATAGGAAGGCTACTGG + Intergenic
1193178254 X:78420928-78420950 AGTCTGAAAAGGCAGGCTGAAGG - Intergenic
1193228688 X:79016406-79016428 ATGTTGAAGAGGAATGGTGAGGG - Intergenic
1193643658 X:84041521-84041543 ATGTTGAATAGGAGAGCTGAAGG + Intergenic
1193947553 X:87756511-87756533 CTTCTGAATAAGAAGGTTGATGG + Intergenic
1194037292 X:88891847-88891869 ATTTTTAATAAGTAGGCTCAAGG + Intergenic
1194613929 X:96078232-96078254 ATGTTGAATAGGAGTGGTGAGGG + Intergenic
1194866179 X:99070805-99070827 ATTTTGATTAGGAAGGGAAAAGG - Intergenic
1195142332 X:101974598-101974620 ATGTTGAATAGGAGTACTGAGGG + Intergenic
1195584856 X:106553098-106553120 ATTTTTGATAGGAAGGCTACAGG - Intergenic
1195847105 X:109240635-109240657 ATTTTTGATAGGAAGGCTACGGG + Intergenic
1196460265 X:115922537-115922559 ATTTTTGATAGGAAGGCTACGGG + Intergenic
1197523051 X:127523601-127523623 ATGTTGAATAGGAATGGTGAGGG - Intergenic
1197889479 X:131254736-131254758 AATTTAAGTTGGAAGGCTGAGGG - Intergenic
1198499531 X:137229278-137229300 ATGTTGACTAGGAAGGCTGTAGG + Intergenic
1199278367 X:145971897-145971919 TTTTTGATTAGGAAGGCTATGGG - Intergenic
1199637579 X:149827868-149827890 ATTTTAGATAGGAAGGCTAAGGG - Intergenic
1200388113 X:155914396-155914418 ATGTTGAATAGGAGTGGTGAGGG + Intronic
1200471447 Y:3591092-3591114 ATGTTGAATAGGAGTGGTGAGGG + Intergenic
1200711560 Y:6489343-6489365 ATTTTTAATAGGAGGGCTAGGGG - Intergenic
1200763469 Y:7061261-7061283 TTTTTGATTAGGAAGGCTACAGG + Intronic
1200851778 Y:7890833-7890855 ATTTTTGATAGGAAGGCTACGGG + Intergenic
1200878808 Y:8189924-8189946 ATATTGAATAGGAGTGGTGAGGG + Intergenic
1200880423 Y:8206719-8206741 ATTTTTGATAGGAAGGCTATGGG + Intergenic
1201022374 Y:9672636-9672658 ATTTTTAATAGGAGGGCTAGGGG + Intergenic
1201260230 Y:12152138-12152160 ATTTTTAATAGGAAGGCTACAGG + Intergenic
1201271774 Y:12262672-12262694 ATTTTTGATAGGAAGGCTATGGG + Intergenic
1201648589 Y:16262034-16262056 ATTTTTGATAGGAAGGCTATGGG + Intergenic
1201654221 Y:16323267-16323289 ATTTTTGATAGGAAGGCTATGGG - Intergenic
1202074439 Y:21024216-21024238 ATTTTTGATAGGAAGGCTATAGG + Intergenic
1202089703 Y:21176982-21177004 ATTTTTGATAGGAAGGCTATGGG + Intergenic
1202093449 Y:21218020-21218042 ATTTTGAATTCTAAGTCTGAAGG - Intergenic