ID: 1003870664

View in Genome Browser
Species Human (GRCh38)
Location 6:10400076-10400098
Sequence TAGGATACAAAAACTGATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003870659_1003870664 13 Left 1003870659 6:10400040-10400062 CCACTGTTTAATCTTTGCCCTTG 0: 1
1: 0
2: 0
3: 22
4: 195
Right 1003870664 6:10400076-10400098 TAGGATACAAAAACTGATATAGG No data
1003870661_1003870664 -4 Left 1003870661 6:10400057-10400079 CCCTTGGAGAACATATTGATAGG 0: 1
1: 0
2: 1
3: 4
4: 114
Right 1003870664 6:10400076-10400098 TAGGATACAAAAACTGATATAGG No data
1003870663_1003870664 -5 Left 1003870663 6:10400058-10400080 CCTTGGAGAACATATTGATAGGA 0: 1
1: 1
2: 0
3: 9
4: 142
Right 1003870664 6:10400076-10400098 TAGGATACAAAAACTGATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003870664 Original CRISPR TAGGATACAAAAACTGATAT AGG Intronic
No off target data available for this crispr