ID: 1003872755

View in Genome Browser
Species Human (GRCh38)
Location 6:10415016-10415038
Sequence CTCTCGGTCTCGCACCCAAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 49}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003872746_1003872755 26 Left 1003872746 6:10414967-10414989 CCGTCAATTTCCAAAGCATTTTC 0: 1
1: 0
2: 12
3: 110
4: 696
Right 1003872755 6:10415016-10415038 CTCTCGGTCTCGCACCCAAGTGG 0: 1
1: 0
2: 0
3: 2
4: 49
1003872749_1003872755 16 Left 1003872749 6:10414977-10414999 CCAAAGCATTTTCATGGATCGGC 0: 1
1: 0
2: 0
3: 6
4: 44
Right 1003872755 6:10415016-10415038 CTCTCGGTCTCGCACCCAAGTGG 0: 1
1: 0
2: 0
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003872755 Original CRISPR CTCTCGGTCTCGCACCCAAG TGG Exonic
901440836 1:9277342-9277364 GTCTCGGTCTGCCACCCAGGCGG + Intergenic
904789745 1:33010443-33010465 CTCTTGGTCTGGAACCCATGGGG + Intronic
907241560 1:53083983-53084005 CCCTCTGTCACCCACCCAAGTGG - Intronic
907890267 1:58630451-58630473 CTCTTGGTCTGGAACCCATGGGG + Intergenic
915149394 1:153818069-153818091 CTCTCGGCCTGGGGCCCAAGGGG - Exonic
915211691 1:154314167-154314189 GTCTCGCTCTCTCACCCAGGTGG - Intergenic
921739646 1:218669171-218669193 CTCTCTGTCTCTCTCCCTAGGGG + Intergenic
1065801465 10:29356697-29356719 CCCTGGGTCTGGCTCCCAAGGGG + Intergenic
1079999612 11:27332859-27332881 CTCACAGTCTTGCTCCCAAGGGG - Intronic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1088807423 11:113365248-113365270 CTCTCGGTCTCCAACCAGAGAGG + Intronic
1092249470 12:6884656-6884678 CTCTCGGTCCCGCAGCCATGAGG + Intronic
1092249481 12:6884707-6884729 CTCTCAGTCCCGCAGCCACGAGG + Intronic
1098273490 12:68791310-68791332 GTCTCGGTCTGTCACCCAGGCGG - Intronic
1102960030 12:117086455-117086477 CTCTCGCTCTGTCACCCAGGTGG + Intronic
1103180864 12:118910101-118910123 CTCTCACTCTGCCACCCAAGCGG + Intergenic
1104374701 12:128254109-128254131 CTCTCCCTCTCTCACCCAACAGG - Intergenic
1125774495 15:42199414-42199436 CTCACGGTCACGCAGCCAGGGGG + Intronic
1128653622 15:69440426-69440448 TTCTCGATCTCGCTCCCGAGAGG - Exonic
1128804736 15:70522278-70522300 CTCCAGGTCTGGCACCCTAGTGG - Intergenic
1131332747 15:91516916-91516938 CTCTCATTCTCTCTCCCAAGAGG - Intergenic
1135479777 16:22813460-22813482 CGCTCTGTCTCGCACCTATGAGG - Intergenic
1138090068 16:54166584-54166606 CTTTAGGTCTTGCACCCAACGGG - Intergenic
1141624495 16:85254136-85254158 CTCTCGGGATCGCCCCCAAGGGG + Intergenic
1143002561 17:3804045-3804067 GTCTCGCTCTGTCACCCAAGTGG - Intergenic
1147783553 17:42961419-42961441 TTCTGGGTCTCTCACCCTAGAGG - Intronic
1152093501 17:78259255-78259277 CTCCCGGTCTCGCACCCTCATGG - Intergenic
1152240244 17:79157190-79157212 CTCCCCGTCTCCCACCCCAGGGG + Intronic
928510790 2:32001065-32001087 GTCTCGCTCTCTCACCCAGGCGG + Intronic
932463948 2:71901472-71901494 GTCTTGGTTTCTCACCCAAGGGG + Intergenic
936262497 2:110973893-110973915 GTCTCGGTCTCTCACCCCAAGGG - Intronic
1170562624 20:17570119-17570141 CTCTCGGTCCCGCAGCCGTGAGG + Exonic
1175276510 20:57774437-57774459 CTCTCCGTCTCCCAGCCAACAGG - Intergenic
950477182 3:13221657-13221679 CTCTCCGTCTCCTGCCCAAGTGG + Intergenic
960060302 3:113313192-113313214 CTCCAGGTCTCACATCCAAGAGG - Intronic
961191850 3:124968771-124968793 CTCACGGCCTCGCACCTAACTGG - Exonic
968876295 4:3269526-3269548 CTCTCAGCCTCGCACCCCTGGGG + Intronic
969484188 4:7462685-7462707 CTCTGGGTCTGGCACGCAGGAGG + Intronic
969658173 4:8509921-8509943 CCCTGGGTGTGGCACCCAAGGGG + Intergenic
981956647 4:150482534-150482556 CTCTAGGTCTCTTACCCTAGAGG - Intronic
985394763 4:189530703-189530725 CTCTCGGTCTAGCTGCCCAGTGG + Intergenic
998682144 5:144480537-144480559 CTCTCTGTCTCTCACCTAAAGGG - Exonic
1002826264 6:777070-777092 CTCCCCGTTTCCCACCCAAGAGG + Intergenic
1003872755 6:10415016-10415038 CTCTCGGTCTCGCACCCAAGTGG + Exonic
1019101269 6:169632157-169632179 CTCTCGCTCTGTCACCCAGGCGG - Intronic
1025160473 7:56654961-56654983 CACTGGGTCTCACACCCCAGGGG - Intergenic
1039242148 8:35568658-35568680 CTCTCGTTCTGTCACCCAGGTGG - Intronic
1048152102 8:131904142-131904164 CCCGCGGTCACGCAACCAAGCGG - Exonic
1056573280 9:87834761-87834783 CTGGCGGGCACGCACCCAAGCGG - Intergenic
1058827242 9:108786006-108786028 CTCTTGGTCTGGGACTCAAGAGG - Intergenic
1060959095 9:127666402-127666424 GTCTCGCTCTGTCACCCAAGCGG + Intronic
1062362077 9:136193014-136193036 CTCCCGGTCTCGGACCCTGGTGG - Intergenic