ID: 1003872779

View in Genome Browser
Species Human (GRCh38)
Location 6:10415113-10415135
Sequence GTGGAGGAGGAGAAGGAGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8596
Summary {0: 1, 1: 35, 2: 448, 3: 1832, 4: 6280}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003872765_1003872779 17 Left 1003872765 6:10415073-10415095 CCGGCGGTGAGCGCAGGAGGAGG 0: 1
1: 0
2: 2
3: 26
4: 242
Right 1003872779 6:10415113-10415135 GTGGAGGAGGAGAAGGAGGAGGG 0: 1
1: 35
2: 448
3: 1832
4: 6280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003872779 Original CRISPR GTGGAGGAGGAGAAGGAGGA GGG Exonic
Too many off-targets to display for this crispr