ID: 1003872901

View in Genome Browser
Species Human (GRCh38)
Location 6:10415782-10415804
Sequence GGCGCTGCGGCCCGAGGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003872901_1003872909 -7 Left 1003872901 6:10415782-10415804 CCACCCCCTCGGGCCGCAGCGCC No data
Right 1003872909 6:10415798-10415820 CAGCGCCTTGGGAGTTTTATTGG 0: 1
1: 0
2: 0
3: 7
4: 96
1003872901_1003872911 12 Left 1003872901 6:10415782-10415804 CCACCCCCTCGGGCCGCAGCGCC No data
Right 1003872911 6:10415817-10415839 TTGGCTTTGAGCTTTCCCCCAGG No data
1003872901_1003872912 16 Left 1003872901 6:10415782-10415804 CCACCCCCTCGGGCCGCAGCGCC No data
Right 1003872912 6:10415821-10415843 CTTTGAGCTTTCCCCCAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003872901 Original CRISPR GGCGCTGCGGCCCGAGGGGG TGG (reversed) Intronic