ID: 1003872901

View in Genome Browser
Species Human (GRCh38)
Location 6:10415782-10415804
Sequence GGCGCTGCGGCCCGAGGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 450
Summary {0: 1, 1: 0, 2: 1, 3: 59, 4: 389}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003872901_1003872911 12 Left 1003872901 6:10415782-10415804 CCACCCCCTCGGGCCGCAGCGCC 0: 1
1: 0
2: 1
3: 59
4: 389
Right 1003872911 6:10415817-10415839 TTGGCTTTGAGCTTTCCCCCAGG No data
1003872901_1003872912 16 Left 1003872901 6:10415782-10415804 CCACCCCCTCGGGCCGCAGCGCC 0: 1
1: 0
2: 1
3: 59
4: 389
Right 1003872912 6:10415821-10415843 CTTTGAGCTTTCCCCCAGGTTGG No data
1003872901_1003872909 -7 Left 1003872901 6:10415782-10415804 CCACCCCCTCGGGCCGCAGCGCC 0: 1
1: 0
2: 1
3: 59
4: 389
Right 1003872909 6:10415798-10415820 CAGCGCCTTGGGAGTTTTATTGG 0: 1
1: 0
2: 0
3: 7
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003872901 Original CRISPR GGCGCTGCGGCCCGAGGGGG TGG (reversed) Intronic
900165855 1:1244049-1244071 CCCGCTGCTGCCCCAGGGGGCGG - Exonic
900244272 1:1630317-1630339 GGCGCGGCGGGCCGGGGGCGGGG - Exonic
900396795 1:2456369-2456391 GGCGGGGCGGCCCTGGGGGGCGG + Intronic
900438607 1:2642742-2642764 TGCGCTGCGCCCCCCGGGGGAGG - Intronic
900671357 1:3856957-3856979 GGTGCCGCGGCCCGGGGAGGCGG + Exonic
900996682 1:6126740-6126762 GGTGCTGCGTCCCCAGGAGGAGG - Exonic
900996935 1:6127899-6127921 GGGGCTGCGGCTGGAGGGCGGGG + Intronic
901086796 1:6615398-6615420 GGCCCTGGGGTCCAAGGGGGTGG + Intronic
901109574 1:6784750-6784772 GTCGCTGCCGGCCGTGGGGGAGG - Intergenic
901109912 1:6785811-6785833 CGGGCTGGGGCCGGAGGGGGCGG + Intronic
903190276 1:21652170-21652192 AGCGCGGCGGCTCGAGGGGGCGG - Intronic
903296256 1:22345019-22345041 GGAGCTGATGCCCCAGGGGGTGG - Intergenic
903349833 1:22710949-22710971 GGCGCCGCGGCCCGAGGCCCCGG + Exonic
903925131 1:26826618-26826640 GGCGCTGCGGCGGGAGGCCGCGG + Intergenic
904696938 1:32336124-32336146 GGGGCTGGCGCCCGAGGGGGAGG + Exonic
904751000 1:32741606-32741628 CCCGCTGGGGCCCGAGAGGGCGG - Intergenic
905282142 1:36856048-36856070 GGAGCTGGGGACCGAGGGGTCGG + Intronic
906365399 1:45205908-45205930 GGAGCGGCGGCCCCGGGGGGTGG + Exonic
906518982 1:46456294-46456316 GGCGCTGGGCCCCGGGGAGGAGG + Intergenic
906662662 1:47593750-47593772 GGAGCTGGGGGCCGAGGGGCGGG - Intergenic
906919405 1:50048131-50048153 GGCGATCCGGCCCGAGGCTGCGG - Intronic
906949867 1:50326147-50326169 GGTGCAGCGGGGCGAGGGGGAGG + Intergenic
910788139 1:91022158-91022180 CGGGCTGCGGGCCGCGGGGGTGG + Exonic
910968600 1:92832047-92832069 GGCCCAGCGGCGCTAGGGGGTGG - Exonic
911154523 1:94625179-94625201 GGCTCTGAGGCCCAAGGGGCTGG + Intergenic
914489999 1:148146126-148146148 GGCCCTGGGGCCCGGGGGCGCGG + Intronic
914824635 1:151132381-151132403 GGAGGTGCGGGGCGAGGGGGCGG + Exonic
914869041 1:151458584-151458606 GGCGGAGCGGCCCCTGGGGGTGG - Intronic
915109037 1:153551362-153551384 GGTGCTGGGGGCCGAGGGCGAGG - Intergenic
915213428 1:154325839-154325861 GGAGCTGCGGCCAGACGGGGCGG + Intronic
915932769 1:160070226-160070248 GGCGCTGCGGAGGGAGGGGGCGG - Exonic
916717204 1:167455760-167455782 GGCGCTGGGGGCCGAGGGTCTGG + Intronic
918151123 1:181798900-181798922 GCCAGTGCGGCCCGGGGGGGAGG + Exonic
918166557 1:181954896-181954918 GGGGCGGCGGCCGGATGGGGTGG - Intergenic
918172557 1:182011168-182011190 GGGGCGGCGGCCGGACGGGGCGG - Intergenic
920013739 1:202888828-202888850 CGAGCTGAGGCCCGAGGGGCGGG + Intronic
920051582 1:203167750-203167772 GGCGCTGTGTCACGAGGAGGGGG - Intergenic
920234671 1:204494777-204494799 GGCGCTGCGGCTGGAGCCGGCGG - Intergenic
1063300610 10:4846006-4846028 GGCACTGGGGCCACAGGGGGCGG - Intronic
1063971931 10:11387223-11387245 GGCGCTGGGGCCGGAGGATGAGG + Intergenic
1064028812 10:11870005-11870027 GGCGAGGGGGCCCCAGGGGGCGG + Exonic
1067560398 10:47300842-47300864 GGCGCTGGGGCCCAACGTGGCGG - Exonic
1069010191 10:63363785-63363807 GAGGCTGGGGCCAGAGGGGGAGG - Intronic
1069386179 10:67884940-67884962 GGCGCTGTGGCGGGAGGCGGAGG + Exonic
1069544488 10:69318807-69318829 CGCGCCCCGGGCCGAGGGGGAGG + Intronic
1069984449 10:72273921-72273943 GGCGCAGCAGGCCAAGGGGGAGG + Exonic
1070179175 10:73998049-73998071 GGCGCGGCGACGAGAGGGGGCGG + Intergenic
1071086526 10:81874119-81874141 GACGCTGCTGGGCGAGGGGGCGG - Intergenic
1073265633 10:102226689-102226711 GGGGCCGGGGCGCGAGGGGGTGG + Intronic
1075825773 10:125356181-125356203 GGCCCTGGGGGCCGAGGGGCAGG - Intergenic
1076799169 10:132812667-132812689 GGGGCTGCGGCCACAGGGGGTGG + Intronic
1077096747 11:802206-802228 GGAGCTGCAGCCCCATGGGGTGG - Exonic
1077097523 11:805290-805312 GGGGGCGCGTCCCGAGGGGGCGG - Intronic
1077221646 11:1420643-1420665 GGAGCTGGGGACCAAGGGGGTGG - Intronic
1077360854 11:2139563-2139585 GGCCCTGGGGCCCCGGGGGGGGG + Intronic
1079128535 11:17734956-17734978 GGCGCTGCCGGCCGAGACGGGGG - Exonic
1081863463 11:46347321-46347343 TGCGCTGCAGCCCGCTGGGGCGG - Intronic
1081938137 11:46918594-46918616 GGGGCTGCGGCGCGGGGGGCGGG - Exonic
1082817044 11:57515740-57515762 GGAGCTGCGCCCCGAGGTGGGGG + Exonic
1083616413 11:64028682-64028704 GGAGCTGCGGGAGGAGGGGGAGG - Intronic
1083648442 11:64186378-64186400 GGCGCTGGGGCCGGACGGGGCGG + Intronic
1083672131 11:64305622-64305644 GGCGGCGCGGCCCGAGGAGGCGG + Intronic
1083758424 11:64803255-64803277 GGGGCTGAGGCCCGGGGGCGGGG + Intergenic
1084087173 11:66860012-66860034 TGCGCTGCGGCCGGGGCGGGGGG - Exonic
1084171273 11:67401969-67401991 GGCGCGGCGGCCCGGGGGGCGGG + Intronic
1085460317 11:76689474-76689496 AGCCCTCTGGCCCGAGGGGGTGG + Intergenic
1088462163 11:110093295-110093317 GGGGCTGCGGCCCGCGGAGAGGG + Intergenic
1088648441 11:111937115-111937137 CGTGCTGCGGCCCGGGCGGGGGG + Intronic
1089302027 11:117504599-117504621 GGCTCTGGGGCCCCAGGGGAGGG + Intronic
1089397619 11:118146142-118146164 GGCGCTCGGGGACGAGGGGGCGG - Intronic
1089454680 11:118619130-118619152 GGCGCTGTGGTCCCAGGGTGGGG - Intronic
1089556255 11:119317233-119317255 CGCGCCGCAGCCCTAGGGGGCGG + Intronic
1089671854 11:120062305-120062327 GAGGCTGCGGCCCCCGGGGGCGG + Intergenic
1090817811 11:130314523-130314545 GGCGCGGCGGCCCGAGATAGGGG - Exonic
1091041271 11:132284056-132284078 GGGGCTGAGGCCCCAGGGGCTGG - Intronic
1093435258 12:19129510-19129532 GCCGCAGGGGCCCGAGGGAGGGG + Intergenic
1093435386 12:19129905-19129927 GGCACGGGGGCCCGCGGGGGCGG + Intronic
1093462473 12:19419235-19419257 GGCGCTGGGAGCCGAGGAGGAGG - Intronic
1094219452 12:27975987-27976009 GGCGTTGCGGCCCCTGGGGTAGG - Intergenic
1094845511 12:34359691-34359713 GGCACTTTGGCCCGTGGGGGGGG + Intergenic
1095261774 12:40106065-40106087 GGCGCTGCGGAGCGGGCGGGAGG + Intronic
1095954287 12:47797567-47797589 GGCCCTGGGACCTGAGGGGGAGG + Intronic
1096396563 12:51270407-51270429 GGCGCAGAGGCCGGAGGGGGTGG + Exonic
1096529324 12:52233340-52233362 GGCGCCGCGGCCCGAGAAGGCGG - Exonic
1096634328 12:52948989-52949011 GGCGGAGCGGCCCGGGGCGGAGG + Exonic
1096983724 12:55743364-55743386 GGAGCTGCGGCCCCGGGGGGAGG + Exonic
1096994312 12:55829507-55829529 GGCCGGGCGGCTCGAGGGGGAGG - Exonic
1097155104 12:57006555-57006577 GGCGCTGCGGGCCGGGCGGCGGG - Intergenic
1097155125 12:57006605-57006627 GGCGCTGCGGCCGGGCGGCGGGG - Intergenic
1100309072 12:93377854-93377876 GGCGCAGTGGCGCGCGGGGGAGG + Intergenic
1100469080 12:94873922-94873944 GGCGAAGCGGCCCGAGGAGGCGG - Intergenic
1100565631 12:95790916-95790938 GCCGCTGCCGCCCGGGGGGGGGG + Intronic
1102038060 12:109783360-109783382 GGGGCTGGGGCCTGAGGTGGAGG + Exonic
1102278161 12:111598716-111598738 GGCGGCGCGGGCCGCGGGGGAGG + Intronic
1102933879 12:116881354-116881376 GGCGCAGAGGCCGGAGGGAGAGG - Exonic
1104289501 12:127455388-127455410 GGCCCTGCGGGGCGGGGGGGGGG - Intergenic
1104857446 12:131908767-131908789 GGCGCGGCGGCCGGCGGGGTTGG - Exonic
1105240914 13:18609303-18609325 GGCGCTGCGGCCGGAGGAGCTGG + Intergenic
1107087986 13:36446658-36446680 GGGGATGGGGCCCGAGGTGGGGG + Intergenic
1108221081 13:48233546-48233568 GGCAGTGCGCCCCGAGGTGGCGG + Intronic
1110705971 13:78602250-78602272 GGCGCGGCGGCCGGCGGCGGCGG - Exonic
1111950817 13:94707709-94707731 GACGCTGTCGCGCGAGGGGGTGG - Intergenic
1112504752 13:99969145-99969167 GCGGCTGCGGCGCGAGGCGGTGG - Intronic
1113808603 13:113123933-113123955 GGCAGTGTGGCCTGAGGGGGAGG - Intronic
1114452535 14:22836746-22836768 GGCGGTGCGACCCCAGGGCGTGG + Exonic
1115120109 14:29928004-29928026 GGAACTGCGGGCGGAGGGGGCGG - Intronic
1119325899 14:73759502-73759524 GCAGCTGCGGGCCGAGGGCGCGG + Intronic
1119357507 14:74019303-74019325 GGCGCCGCGGCGCGCGGGGTGGG - Exonic
1120200522 14:81533644-81533666 GGGCCTTCAGCCCGAGGGGGCGG + Intronic
1121075040 14:91060669-91060691 GGCGGAGCGGCCTGAGGAGGCGG - Intronic
1122108795 14:99480907-99480929 GCGGCTGCGGCCCGGGGGCGGGG - Intergenic
1122736949 14:103848375-103848397 GGCGCTCAGGCCCGAGGGGGCGG - Intergenic
1122905653 14:104800479-104800501 GGGGCGGGGGCCGGAGGGGGCGG - Intergenic
1122910757 14:104826668-104826690 GGCGGGGCTGCCGGAGGGGGCGG + Intergenic
1122910766 14:104826686-104826708 GGCGGGGCTGCCGGAGGGGGCGG + Intergenic
1123025037 14:105420269-105420291 GGCTCGGCGGCCCGGGGGTGGGG + Intronic
1124118436 15:26867996-26868018 GCCGCTGCGGACCGCGCGGGTGG + Intronic
1124373292 15:29115496-29115518 GGGGCTGCTGGCCGTGGGGGCGG - Intronic
1125575401 15:40752038-40752060 GGCGCTGCGGCGGGAGGTGGAGG - Exonic
1127995561 15:64151667-64151689 GGGCCTGCGGACCGAGGGGGCGG + Intergenic
1128322027 15:66701159-66701181 GGCGCCGCGCCCGGGGGGGGAGG + Intergenic
1129144330 15:73633359-73633381 GGCGCTGCGGCGGCAGGAGGAGG - Exonic
1129541109 15:76347377-76347399 GGCGCTCCGGCTCGAGGGCGGGG - Intergenic
1131054559 15:89367852-89367874 GGGGCTGCGGGCCTAGGTGGCGG + Intergenic
1132333363 15:101027541-101027563 GCCCCTGTGGCCTGAGGGGGTGG - Intronic
1132464771 16:72441-72463 GGGGCTGCGTCCGGAGGGCGGGG - Intronic
1132595594 16:747798-747820 GGAGATGAGGCCCGAGGTGGCGG + Intronic
1132609308 16:807408-807430 GGCCCGGCGGCCAGAGGGAGCGG - Intronic
1132656218 16:1043041-1043063 GGCTCTGCTGGCCGAGGGGCGGG - Intergenic
1132719804 16:1309968-1309990 TGGGCTGCGGCCCGAGCGGCCGG + Intronic
1132839934 16:1974000-1974022 GGCCCTGGGGACTGAGGGGGTGG + Intronic
1132853919 16:2036463-2036485 GGCGCGGAGGCCAGAGCGGGCGG - Exonic
1132942246 16:2514059-2514081 AGCTCTGCGGGCCGAGGCGGTGG - Exonic
1133006253 16:2883329-2883351 GGCGCTGTCGCCGGAGAGGGAGG + Exonic
1134433500 16:14234206-14234228 GGAGCTGCAGGCCGTGGGGGAGG - Exonic
1135821909 16:25692457-25692479 GGCGGCGCGGCCAGAGGTGGAGG - Exonic
1136114648 16:28087189-28087211 GGAGCTGGGCCCCCAGGGGGTGG + Intergenic
1136153058 16:28364806-28364828 GGCCCTGCGGCCCTGGGAGGGGG + Intergenic
1136210025 16:28750467-28750489 GGCCCTGCGGCCCTGGGAGGGGG - Intergenic
1136414747 16:30096233-30096255 GCCGCTGCGGCGGGAGGGGGAGG + Intronic
1137531588 16:49281814-49281836 GGCGCTGCAGCCGGAGCGGGCGG + Exonic
1137655441 16:50154269-50154291 GGCTCTGCGGCCCGATGGCCTGG + Intronic
1137665221 16:50245909-50245931 GGCGCTGCCGCGGGAGGGAGCGG - Intergenic
1137710077 16:50560339-50560361 GGAGCTGCAGCCCGAGGAGGAGG + Intronic
1138327831 16:56190923-56190945 GGCTCTGCGGCCCCAGCGGCTGG + Intergenic
1139778282 16:69330597-69330619 CGCGCTGCGGCCGGAAGGGGCGG - Intronic
1140046208 16:71441899-71441921 GGGGCTGCGGGCCGATGGCGGGG + Intergenic
1141665297 16:85462690-85462712 GGCGCCGCGGCGCGGGAGGGAGG + Intergenic
1142221230 16:88856270-88856292 GACCCGGCGGCCCGAGGTGGCGG + Intronic
1142274742 16:89112031-89112053 GGCACTGGGGCCCGTGGCGGAGG - Intronic
1142810474 17:2393502-2393524 GGCGCCACGGCCCGAGTGTGGGG - Intronic
1143115104 17:4577557-4577579 GGGGCTGGGACCCAAGGGGGAGG + Intergenic
1143231860 17:5363082-5363104 GGGGCTGGGGCCGGAGAGGGGGG - Intronic
1143865054 17:9917455-9917477 GGCTCCGGGGCCCCAGGGGGAGG + Intronic
1144718213 17:17449166-17449188 GGCGTTGCAGCCAGAGGGGCTGG - Intergenic
1145190605 17:20840777-20840799 GGCCCTGGGGCCCGGGGGCGCGG + Intronic
1145249090 17:21287667-21287689 GGCGCTGGGGCCAGTGGGTGGGG + Intronic
1146053314 17:29568674-29568696 GGCGCTGGGGCTGGAGGGGCGGG + Exonic
1146054041 17:29572493-29572515 GGCGCTGCTGCGCGAGGGGCCGG - Exonic
1146182940 17:30709084-30709106 GGCGGCGCGGCCGGAGGGGGGGG - Intergenic
1146374233 17:32283790-32283812 GGCGCCGCGGTCCAAGGAGGAGG + Intronic
1147150368 17:38510555-38510577 GTCGCTGCGGCCCCCGGCGGCGG + Exonic
1147158953 17:38559699-38559721 GGTGCTGCTGGCCGAGGGCGGGG + Exonic
1147179482 17:38675041-38675063 GGCGGTGCCGCCGGAGGGGTGGG - Exonic
1147257975 17:39193498-39193520 GGCCCTGCTGGCCTAGGGGGTGG + Intronic
1147864863 17:43545622-43545644 GGCCGTGCGGCCGGAGGGAGCGG - Exonic
1147907591 17:43833043-43833065 GGCGCCGCGGCGGGAGGGGCGGG - Intronic
1148617803 17:49013807-49013829 CGCCCTGGGCCCCGAGGGGGAGG - Intronic
1150041249 17:61863530-61863552 GGCGCTGGGAGTCGAGGGGGCGG - Intergenic
1150211971 17:63446546-63446568 GGATCTGCGGCCTGCGGGGGTGG + Intergenic
1150675810 17:67245271-67245293 GGAGGCGCGGCCGGAGGGGGCGG - Intronic
1151321698 17:73356442-73356464 GGCGCTGCAGACCCAGGGAGAGG - Intronic
1151491127 17:74432707-74432729 GGCGCTGCGGCTCGGGCTGGAGG + Intronic
1151559986 17:74864802-74864824 GGTGCTGGGGCCAGAGTGGGAGG - Exonic
1152392342 17:80010317-80010339 GGAGCCGCGGCCCGAGGCCGGGG - Exonic
1152412333 17:80133839-80133861 GGCACTGCTGGCCGAGCGGGAGG - Intergenic
1152583361 17:81178716-81178738 GGGGCTGCGGGCGGTGGGGGTGG - Intergenic
1152610003 17:81310717-81310739 GGCGGTGCTGCCCCAGCGGGAGG + Intergenic
1152627375 17:81393831-81393853 GGGGCTGCGGGCCGCGGGCGGGG - Intergenic
1154448056 18:14450605-14450627 GGCGCTGCGGCCGGAGGAGCTGG - Intergenic
1158436025 18:57435916-57435938 GGCGCCGCGGCCCGCGTGGTGGG - Exonic
1158954118 18:62523466-62523488 GGAGCCGCCGCCCGAGGCGGAGG + Exonic
1160491074 18:79337018-79337040 GGCTCTGGGGACAGAGGGGGAGG - Intronic
1160491112 18:79337260-79337282 GGCTCTGGGGACAGAGGGGGAGG - Exonic
1160726857 19:621186-621208 GGCCGTGCGGGCCGAGCGGGCGG + Exonic
1160768702 19:821156-821178 GGCGGGGAGGCCGGAGGGGGTGG - Intronic
1160773427 19:843881-843903 GGCGCTGGGGTCTGCGGGGGTGG - Exonic
1160789461 19:916969-916991 GGGGCTGGGGCTCCAGGGGGTGG - Intergenic
1160804112 19:984254-984276 GGCCCCGCGGCCCCAGCGGGTGG - Exonic
1160864376 19:1250555-1250577 GGGGCCGGGGCCCGAGGGGGCGG - Intronic
1160996710 19:1885361-1885383 GGCCCTGGGGCCCGGGGGCGCGG - Exonic
1161241142 19:3224637-3224659 GGCGCGGGGGCCCGGGAGGGAGG + Intergenic
1161264864 19:3359515-3359537 GGTCCTGCGGGCCGGGGGGGCGG + Intergenic
1161289116 19:3483376-3483398 GGGGCTGGCGGCCGAGGGGGAGG - Intergenic
1161510850 19:4670241-4670263 GGCGCTGAGGCCGGCGGAGGCGG - Exonic
1161683350 19:5691461-5691483 GGCGCTGCCGGCCGAGGGGCGGG + Intronic
1161811817 19:6475748-6475770 CGCGCTGCGGACCGAGGGGACGG + Exonic
1161854220 19:6754301-6754323 GGCGCTGCGGCCAGGGGCGGCGG - Exonic
1161979764 19:7624301-7624323 GGAGCTGGGGCGCGAGGAGGAGG - Exonic
1162524214 19:11197845-11197867 GGCTCGGCGGCGGGAGGGGGTGG + Intergenic
1162577162 19:11505753-11505775 GGCGCTAGAGCCCGAGGCGGAGG - Exonic
1162577242 19:11506141-11506163 CGGGCTGTGGCCCGAGGAGGCGG - Exonic
1162786124 19:13036101-13036123 GGGGCTGCGGCTGGAGGGAGGGG + Intronic
1162861175 19:13506511-13506533 GGCGCGGGGGCCCGGGGAGGAGG + Intronic
1162954458 19:14090524-14090546 GGCGCTGCGCCCCCCGGGGGGGG - Exonic
1163012203 19:14433324-14433346 GCCGCTGGGGCCGGAGGGCGCGG + Intronic
1163116442 19:15191719-15191741 GGCACTGCGGCCAGAGGGAGCGG - Intronic
1163447041 19:17352978-17353000 GGCGGTGGGGCCGGAGGGTGCGG - Intronic
1163462655 19:17448315-17448337 GGGGCTGCGCGCCGAGGGGCTGG - Exonic
1163774160 19:19208244-19208266 GGGGCTGCTGCCAGTGGGGGAGG - Intergenic
1164595080 19:29526939-29526961 GGCGGTGCGGCCAGGGGCGGGGG + Intronic
1164713513 19:30375553-30375575 TGCGCTGCGGCCCGGGGTGTGGG + Intronic
1165017448 19:32891169-32891191 GGCTCTGCGGCTGGAGGGGGTGG - Intronic
1165247370 19:34505177-34505199 GGCCCTGAGGCCTGAGGTGGTGG + Exonic
1165624324 19:37271704-37271726 GGCGGCGCAGCCCGAGGCGGCGG + Intergenic
1165625408 19:37276769-37276791 GGCGGCGCAGCCCGAGGCGGCGG + Intergenic
1165625941 19:37279294-37279316 GGCGGCGCAGCCCGAGGCGGCGG + Intergenic
1165626485 19:37281821-37281843 GGCGGCGCAGCCCGAGGCGGCGG + Intergenic
1165627024 19:37284346-37284368 GGCGGCGCAGCCCGAGGCGGCGG + Intergenic
1165627567 19:37286870-37286892 GGCGGCGCAGCCCGAGGCGGCGG + Intergenic
1165628102 19:37289394-37289416 GGCGGCGCAGCCCGAGGCGGCGG + Intergenic
1165628644 19:37291920-37291942 GGCGGCGCAGCCCGAGGCGGCGG + Intergenic
1165629184 19:37294445-37294467 GGCGGCGCAGCCCGAGGCGGCGG + Intergenic
1165629727 19:37296971-37296993 GGCGGCGCAGCCCGAGGCGGCGG + Intergenic
1165630269 19:37299498-37299520 GGCGGCGCAGCCCGAGGCGGCGG + Intergenic
1165630808 19:37302036-37302058 GGCGGCGCAGCCCGAGGCGGCGG + Intergenic
1166083276 19:40458326-40458348 GGCGCTGGGGGCCGAGGTGTAGG + Intronic
1166101946 19:40576383-40576405 GCCGCTGGGGCCCGGGGGTGTGG + Exonic
1166838406 19:45681669-45681691 CGCGCTGCCGCCAGAGGGCGGGG - Intronic
1166882937 19:45940206-45940228 GGCGGGGCGGGCGGAGGGGGCGG - Exonic
1167019070 19:46861015-46861037 GGCGCGGCGGCAGGAGGAGGTGG + Intergenic
1167056079 19:47112381-47112403 GGGGCTGCGTCCCCGGGGGGAGG - Intronic
1167071741 19:47226162-47226184 GGCGCTGCGGGCCGCGCGAGAGG + Intronic
1167134618 19:47609344-47609366 GGCGCTGCGCCCCGGCTGGGGGG - Intronic
1167459277 19:49615796-49615818 GGTGCTGGGGCCTTAGGGGGAGG - Exonic
1167463406 19:49638187-49638209 GGGGCTGGGGCCCGAGGGTGGGG - Intronic
1167558496 19:50210569-50210591 GGCGCTGCGGGACGAAGGCGAGG + Exonic
1167569147 19:50276144-50276166 GGCGCTGCGGGGCGAGCTGGAGG + Exonic
1167638668 19:50668642-50668664 GCGGCCGCGGCCCGAGCGGGCGG + Exonic
1167648518 19:50718223-50718245 AGCGCTGCCGCGCGTGGGGGAGG - Intronic
1168240679 19:55087369-55087391 GGCGGTGAGCCCCGAGGAGGGGG + Exonic
1168272457 19:55257805-55257827 GGCGCTGGGCACCGAGGAGGGGG - Intronic
925222601 2:2154021-2154043 GGAGGTGCTGCCCGAGGGGCTGG + Intronic
926914339 2:17878501-17878523 GGCGCCCCGGGCCGAGGGCGCGG - Intronic
927606614 2:24491663-24491685 GCCGCGGAGGCCCTAGGGGGCGG + Intergenic
927811831 2:26184757-26184779 GGCGCTGCGCCGCGAGGGCCCGG + Exonic
929452702 2:42047866-42047888 GGCCGGGCGGCCGGAGGGGGCGG + Intergenic
929808493 2:45169306-45169328 GGCGCTGGAGGCCGACGGGGAGG + Intergenic
929982973 2:46698822-46698844 CGGGCTGCGGCCCGAAGGGAGGG - Intergenic
930011476 2:46941199-46941221 GGCGCCGGGGCCCGGGGCGGAGG + Exonic
931557600 2:63521826-63521848 TGCGCTGTGGCCCGAGAGTGTGG - Intronic
932042958 2:68319417-68319439 GGCGCGGCGGCTCCGGGGGGCGG + Exonic
932152675 2:69387265-69387287 CGCGCTGCGCGCCGAGGGGCGGG - Intergenic
932457387 2:71858218-71858240 GGGGCTGTGGCCCTGGGGGGTGG - Intergenic
932562726 2:72887364-72887386 GGCGGTGCGGCCGCGGGGGGCGG - Exonic
932777960 2:74539739-74539761 CGCCCTGCGGCCCCAGGAGGTGG - Intronic
933858547 2:86441824-86441846 GGCGCTGGGGCCCGGGTGTGTGG + Intronic
935070373 2:99688759-99688781 GGCGCAGTGGCCTGAGGGGGTGG - Intronic
935137650 2:100321808-100321830 GGCGCTGCGGCCGGAGGAGCTGG - Exonic
935301573 2:101697778-101697800 GGCGCCGGGGCCTGAGGCGGCGG + Intronic
940293456 2:152099074-152099096 TGGGCTGCGGACGGAGGGGGAGG + Exonic
940887499 2:159002170-159002192 GGACCTGCGGCCGGAGGGGCTGG + Intronic
941088511 2:161146963-161146985 GGGGCTGAGCCCCTAGGGGGAGG - Intronic
942455663 2:176136718-176136740 GGCGATGCGGACCGAGTGAGCGG - Intergenic
944531290 2:200670169-200670191 GGCGCTGTTGCCAGAGGGGAGGG - Intronic
944579149 2:201116902-201116924 GGGGCTGCGGCTGCAGGGGGCGG - Intronic
944715984 2:202376452-202376474 GGCGTCGCGGACCGAGGGCGGGG - Intergenic
946311265 2:218883731-218883753 GGCGGTGGGGCGGGAGGGGGCGG - Intronic
946313853 2:218897176-218897198 GCCGCTGCGGTGCGCGGGGGTGG + Intronic
946391430 2:219418942-219418964 GGAGCTGCGGCGCCAGGTGGAGG + Exonic
947119069 2:226798350-226798372 GGAGCTGCGGCCCTCGGGGCGGG - Exonic
947650201 2:231780698-231780720 GGGGCTGCGGCCCGCGGAGAAGG - Intronic
948053736 2:234996518-234996540 GTCGCTGAGGCCCCAGTGGGCGG - Intronic
948808316 2:240462456-240462478 GGCGCTGCGGCCCTTCGGGGAGG + Exonic
948850056 2:240701431-240701453 GGGGCTGCGGCCGGAGGTGGTGG - Intergenic
948886699 2:240888391-240888413 GGGGCTGCGGCCCAGGTGGGTGG + Exonic
949079870 2:242088468-242088490 GGCGCGGGGGCGCGGGGGGGCGG - Intergenic
1169117005 20:3072292-3072314 GGCGCTCCGGGGCCAGGGGGAGG + Intronic
1169278678 20:4249550-4249572 GCCGCTGAGGGCCAAGGGGGAGG - Intergenic
1170150506 20:13221726-13221748 GGCGCGGCGGCCGGCGGCGGCGG - Intergenic
1172039061 20:32031161-32031183 GGCGCAGCGGCCCGAGGCACAGG + Exonic
1172146498 20:32761950-32761972 GGCACTGCGGCTGGAGGTGGGGG + Intergenic
1173221731 20:41137387-41137409 GGCGCGGCGGGCCGACGGGCGGG + Intronic
1173279956 20:41618721-41618743 GGTCCCGCGGGCCGAGGGGGCGG + Intergenic
1173734193 20:45348082-45348104 GGGGCTGAGGCCCGGGGAGGCGG + Intronic
1173790122 20:45823047-45823069 GGCCCTGGAGCCCGAGGCGGCGG - Intergenic
1173954040 20:47017009-47017031 GGCTCTGCAGCCCTAGAGGGTGG + Intronic
1174973587 20:55305732-55305754 GGGCCTGCGCCCCTAGGGGGAGG + Intergenic
1175349635 20:58309304-58309326 GGGGCTGCGGCGAGAGGGGACGG + Intergenic
1175743236 20:61435490-61435512 TGCACTGCGGCCGGAGGAGGTGG + Intronic
1176137326 20:63529973-63529995 GGCCCTGAAGCCCGTGGGGGAGG + Intronic
1176143211 20:63554093-63554115 GACGCTGCGGCCCGGGGGCGGGG - Exonic
1176448174 21:6840088-6840110 GGCGCTGCGGCCGGAGGAGCTGG + Intergenic
1176826344 21:13705110-13705132 GGCGCTGCGGCCGGAGGAGCTGG + Intergenic
1177166727 21:17612502-17612524 GGGGCTGCGGGCCGCGAGGGCGG - Intronic
1178488140 21:33031720-33031742 GGTGCTGAGGCCAGAGGAGGAGG - Intergenic
1178708202 21:34890796-34890818 GGCGCTGCGGCCCCTGCGGGCGG - Intronic
1179731521 21:43370557-43370579 GCCGCTGGGGCCCCAGGGGAGGG - Intergenic
1179828993 21:43984217-43984239 GGCACAGCTGCCCGAGTGGGCGG - Exonic
1180187249 21:46145846-46145868 CGCTCTGCGGCCCCCGGGGGCGG - Exonic
1181121678 22:20671213-20671235 GGCCCTGGGGCCCGGGGGCGCGG - Intergenic
1181334646 22:22118253-22118275 GGCCCTGGGGCCCGGGGGCGCGG - Intergenic
1181934560 22:26429426-26429448 GACGCCGCCGCCCGAGGGCGCGG - Exonic
1182358797 22:29734859-29734881 GGCTGTGCGGCCAGAGGTGGAGG + Intronic
1182445564 22:30387421-30387443 GGGGCCGCGGCCGGACGGGGCGG + Intronic
1183339805 22:37273974-37273996 TCCGCTGCAGCCCGAGGGGGTGG - Intergenic
1183720134 22:39557777-39557799 GGCGCTCCGGGCCGGGGCGGGGG - Intergenic
1184689234 22:46109975-46109997 GGGGCTGGGGGCCCAGGGGGAGG + Intronic
1185127531 22:49019867-49019889 GGACCTGCTGTCCGAGGGGGTGG - Intergenic
950940338 3:16884962-16884984 CGCGCGGCGGCCCGAGGCGGCGG + Intronic
951881529 3:27484669-27484691 GGCGGTGCGTCCTGAGGAGGTGG - Intergenic
952382959 3:32818492-32818514 GGCGCTCCGGCGGGAGCGGGCGG + Exonic
953657088 3:44862288-44862310 GGCGCTGCGGTCAGCTGGGGTGG + Intronic
954316210 3:49803191-49803213 GGCCCCGCGGCCAAAGGGGGCGG - Intergenic
954459171 3:50616954-50616976 GGCGTGGCTTCCCGAGGGGGCGG - Intronic
954693990 3:52410515-52410537 GGCGCTGAGGCGCGAGAGGAGGG + Intergenic
954795796 3:53160942-53160964 GACGCTGAGGCCCGGTGGGGAGG - Intronic
954822428 3:53341962-53341984 GGCTCTGAGGCCAGAGGTGGTGG - Intronic
956373624 3:68590540-68590562 GTCGCTGCAGCCAGAGGGGTGGG + Intergenic
959577524 3:107950314-107950336 GGCACTGTGGCCGGCGGGGGCGG + Intergenic
961692605 3:128680862-128680884 GGCACTGCCGCCAGAGGGCGCGG + Intronic
963091621 3:141487658-141487680 GGAGGCGCGGCCCGAGGAGGTGG + Intronic
963236789 3:142963855-142963877 GCTGCGGCGGCCCGAGGAGGGGG - Intergenic
964509758 3:157437796-157437818 GGCGCAGCGCCCAGAGGAGGCGG + Exonic
966919377 3:184602044-184602066 GGGGCTGGGGCCCGCGGGCGGGG + Intronic
967859717 3:194141658-194141680 GGCGCTGGGGCCCGGGGCGGGGG - Intergenic
968235927 3:197029922-197029944 GGCGCCCGGGCCCGAGCGGGAGG - Intergenic
968562093 4:1289594-1289616 CGGGCTGCGGCCCGGGCGGGTGG - Intergenic
968889755 4:3362176-3362198 GGTGCTGGGGACCGAGGTGGGGG + Intronic
968958475 4:3730694-3730716 GGGGCTGGGGCCCCAGGGCGGGG + Intergenic
969490866 4:7498592-7498614 GGCCCTGCGTCCCTAGGAGGTGG - Intronic
971301075 4:25442867-25442889 GGAGCTGCCTCCCGATGGGGAGG + Intergenic
973279307 4:48342069-48342091 GCCGCTGCGGCCCGACGAGCTGG + Exonic
973956490 4:56068328-56068350 GCCGCTGCAGCCTGAGGGGAGGG + Intergenic
975689213 4:76948830-76948852 GGGGCTGCGGCTGGAGGGCGTGG - Intergenic
976629157 4:87219928-87219950 GGAGCCGCGGCCTGCGGGGGCGG - Intronic
976830344 4:89307878-89307900 GGCTCTGCGCCCGGCGGGGGCGG - Exonic
982198512 4:152937722-152937744 GGCGTCGCGGCGCGAGGGTGGGG - Intronic
984626078 4:182009366-182009388 GGACCTGAGGCCCTAGGGGGAGG - Intergenic
985643275 5:1073629-1073651 GGCTCAGCGGGCCGAGGAGGTGG - Exonic
985774300 5:1832818-1832840 GGCTCTGTGGCCGGAGGAGGCGG - Intergenic
986330721 5:6714253-6714275 GGCGCTGGGGCCCGCGGCCGAGG + Intergenic
989178859 5:38556641-38556663 GGGACTGCGGCGCGCGGGGGCGG + Intronic
989379236 5:40797814-40797836 GGCGCCGCGGCCTGAGGGGCTGG - Intronic
989379413 5:40798397-40798419 GGCGCTCAGGCCCGAGGATGCGG - Intergenic
989980082 5:50633170-50633192 GGAGATGCGGCCCGAGGGCTTGG - Intergenic
990724995 5:58743554-58743576 GGAGCTGGGGGCCAAGGGGGAGG - Intronic
991720630 5:69492414-69492436 GACGTTGCGGCCCGAGAGGCGGG - Exonic
992124496 5:73626471-73626493 GGCGCTGCGGCGCGAGGGCTGGG + Intronic
992365136 5:76083268-76083290 GGCACTGCAGCACCAGGGGGAGG + Exonic
993500316 5:88660008-88660030 GGCTCTGCGGCCCTCGGGTGAGG - Intergenic
997129667 5:131264127-131264149 GGGGCTGCGGCCGGAGCGGGCGG + Exonic
997294755 5:132762437-132762459 GGCCCTGGGGCCAGAGGGCGAGG - Intronic
998406876 5:141878921-141878943 GCGGCTTCGGCCGGAGGGGGAGG - Intronic
999300199 5:150486127-150486149 CCCGCTGCGGGACGAGGGGGAGG + Intronic
1001401918 5:171451036-171451058 GGGGGGGCGGCCCGAGGGGACGG - Intronic
1001679160 5:173543732-173543754 GGGGCTGAGGCCAGATGGGGAGG - Intergenic
1001732994 5:173973827-173973849 TGCTCTGCGGCCCACGGGGGCGG + Intronic
1001960724 5:175878993-175879015 GGCGCTGCGGCAGCAGGAGGAGG + Exonic
1002664066 5:180810134-180810156 GCCGCTGGGGGTCGAGGGGGTGG - Intronic
1003645370 6:7910125-7910147 GGCGGTGCGGGAGGAGGGGGCGG - Intronic
1003872901 6:10415782-10415804 GGCGCTGCGGCCCGAGGGGGTGG - Intronic
1003942639 6:11044247-11044269 GGCGCGGCGACCCGGGCGGGCGG + Exonic
1005455711 6:26017854-26017876 GGCGCTAGGGCGCGAGGGGCGGG - Intergenic
1005639828 6:27785360-27785382 TGGGCTGCAGCCCGAGAGGGTGG + Intergenic
1005851882 6:29828514-29828536 GGCGGGGCTGACCGAGGGGGTGG + Intronic
1006123478 6:31822066-31822088 GCCGCTGGGGCCTGAGGGCGGGG - Intergenic
1007924825 6:45642567-45642589 GGCCCTGCGGCCCGACCAGGCGG - Intronic
1008649484 6:53548220-53548242 GGCGGTGCCGCGCGCGGGGGAGG - Intronic
1011520166 6:88196163-88196185 GGAGCTGAGGCCTGAGGGGTGGG + Intergenic
1014205510 6:118651592-118651614 GGCTCTGCCGGCGGAGGGGGCGG - Intronic
1016433145 6:144008434-144008456 GGCGCTGGGGCCCCTGGCGGGGG + Intronic
1017360617 6:153564887-153564909 GGCACTGTGTCTCGAGGGGGTGG - Intergenic
1018150283 6:160931176-160931198 GGGGCTGGGGCCCGGGGCGGGGG + Intergenic
1018876782 6:167827589-167827611 GGCGCGGCGGCGCGCGGGGCCGG + Intronic
1019385707 7:754930-754952 GGGCCTGCGGCCCGGGGGTGAGG - Intronic
1019430772 7:997915-997937 CCCACTGCGGCCCGAGGGTGTGG + Intronic
1019470040 7:1214668-1214690 GGGGATGCGCCCCAAGGGGGAGG - Intergenic
1019529137 7:1494971-1494993 AGCGCTGGGGCCCGTGGGAGCGG - Intronic
1019550504 7:1599904-1599926 GGGGCTGTGGTCCGAGGGGCTGG + Intergenic
1019706127 7:2498067-2498089 GGCGCTGAGGATGGAGGGGGAGG + Intergenic
1019735217 7:2647059-2647081 GAGGGGGCGGCCCGAGGGGGCGG + Intronic
1020046714 7:5046071-5046093 GGCGCTGGGGCCAGAGGGGCCGG + Exonic
1020105336 7:5420107-5420129 GCCGCTGCAGCCAGAGGGGTGGG - Intronic
1020208564 7:6139811-6139833 GGCACTGCGGCCTGTGTGGGAGG - Intronic
1020288809 7:6706730-6706752 GGCGCTGGGGCCCAAGGGGCCGG - Exonic
1021814365 7:24432988-24433010 GGCACGGCGCCGCGAGGGGGCGG + Intergenic
1021868389 7:24980254-24980276 GGGGCGGGGCCCCGAGGGGGCGG + Intronic
1022427663 7:30284550-30284572 GGCCTGGCGGCACGAGGGGGCGG + Exonic
1022504615 7:30902546-30902568 GGAGCTGCAGCCCCAGGGAGTGG + Intergenic
1023862693 7:44225627-44225649 GGAGCAGCGGCTCGAGGAGGGGG - Intronic
1023955590 7:44884708-44884730 GGCGCCGGGGGCCCAGGGGGCGG - Exonic
1025196778 7:56940315-56940337 GGAACTGGGGCCCAAGGGGGAGG - Intergenic
1025675170 7:63636622-63636644 GGAACTGGGGCCCAAGGGGGAGG + Intergenic
1026845828 7:73698762-73698784 GGTGCCGGGGCCCGAGGGGCTGG + Intronic
1027116561 7:75486067-75486089 GGCGCTGGGGCCAGAGGGGCCGG - Exonic
1027121888 7:75527888-75527910 GGCGCTGGGGCCAGAGGGGCCGG - Intergenic
1027275240 7:76549543-76549565 GGCGCTGGGGCCAGAGGGGCCGG + Intergenic
1027400172 7:77798741-77798763 GGCGGGGCGTCCCGAGAGGGCGG - Intergenic
1029720949 7:102364093-102364115 GGCGCTGGGGCCAGAGGGGCCGG + Exonic
1029896507 7:103989745-103989767 GGCGGGGCGGCGCGCGGGGGCGG - Intergenic
1031895923 7:127347808-127347830 GGCGGTGCGGAGCGAGGGCGAGG + Intronic
1034349216 7:150405512-150405534 GGCGCTGCGGCCGTGGGGGGTGG + Intronic
1034451182 7:151138146-151138168 TGCGCTGCTGGCCGAGTGGGGGG - Exonic
1035126074 7:156608277-156608299 GACGCTGCGGCCGCAGTGGGAGG - Intergenic
1035892142 8:3356964-3356986 GGAGCTGCGGCCCCTGGGGTTGG + Intronic
1036466562 8:9003123-9003145 GTCGCCGCGGCCGGAGGGCGGGG + Exonic
1037482006 8:19313921-19313943 GGCGCAGGGGCCAGAGCGGGCGG + Intronic
1037826927 8:22165226-22165248 GGAGCCGCGGACCGAGCGGGGGG + Exonic
1037891069 8:22624019-22624041 GGAGCTGCGGCCTGTGCGGGAGG - Exonic
1041713033 8:60910336-60910358 GGCGCTGCGGCCGGGCCGGGCGG + Intergenic
1042235866 8:66613025-66613047 GGCGCTGCGGGCCGGGGTCGGGG - Exonic
1042859037 8:73295001-73295023 GGCGCTGCGGGACGGGCGGGCGG + Exonic
1043841248 8:85107193-85107215 GGAAGGGCGGCCCGAGGGGGCGG - Exonic
1044569393 8:93700522-93700544 GCCGCGGCGGCGCGAGGGGCGGG + Exonic
1045488593 8:102654068-102654090 GGCTGTGCGGCCCGGGGCGGGGG + Intronic
1048302666 8:133262889-133262911 GGCTCTGCAGCCCCAGGGGATGG + Intronic
1048492771 8:134909920-134909942 GGCACTGGGGTCAGAGGGGGTGG - Intergenic
1049108464 8:140628157-140628179 GGCGCTGCGGCCGGGGGAGCAGG - Intronic
1049167194 8:141133715-141133737 GGGGCTGGGGCCCGAGGGGCTGG + Intronic
1049613641 8:143567211-143567233 GGGGCTGGGGCCCGAGGGCCAGG - Exonic
1049658960 8:143811255-143811277 GGCGCTGCCGCCCGAGATCGGGG - Exonic
1049732442 8:144185623-144185645 GGCGGTGAGGGCCGGGGGGGGGG + Intronic
1052546682 9:29889100-29889122 GGGCCTGAGGCCCTAGGGGGAGG + Intergenic
1052991812 9:34523008-34523030 GGAGGTGCGGCCCCAAGGGGAGG - Exonic
1053280768 9:36818681-36818703 GGCGTTGCCGCTGGAGGGGGCGG - Intergenic
1056442829 9:86637648-86637670 GGCGCTCTTGCCCGTGGGGGTGG + Intergenic
1057432337 9:95005296-95005318 TGCGCTGCGGCGCGCGGGTGCGG + Intronic
1057436856 9:95048551-95048573 GCCGCCGCGGCCGGAGGGGTGGG - Intronic
1057741075 9:97711560-97711582 GGCGCTGCCGCCAGAGGAGGGGG + Intergenic
1057900100 9:98942170-98942192 GGGGCTGCGGCCTGTGGAGGGGG - Intergenic
1059492630 9:114681820-114681842 GGCGCTGCGGGCGGGGGTGGGGG + Intergenic
1060105077 9:120868665-120868687 CGGGGTGGGGCCCGAGGGGGCGG - Intronic
1060594184 9:124838766-124838788 GGCGCCGTGGAGCGAGGGGGCGG + Intergenic
1060811660 9:126614047-126614069 GGCCCCGCGGGCCGCGGGGGGGG - Intergenic
1061449690 9:130661345-130661367 GGCGCGGCTTCCCGAGGGGCCGG - Intergenic
1061805141 9:133133545-133133567 GGCGCTGGGGCCTGGGGGTGAGG + Intronic
1062022558 9:134326354-134326376 GGCGCTGCGGCGCCGGCGGGGGG - Intronic
1062162560 9:135088191-135088213 GGGGCTCCGGACCGAGGAGGGGG - Intronic
1062355003 9:136157786-136157808 GGAGCTGGGGCCAGAGGGGAGGG + Intergenic
1062499531 9:136846309-136846331 GGCGCTGCCGGCCGAGGCGGGGG - Exonic
1203521017 Un_GL000213v1:44430-44452 GGCGCTGCGGCCGGAGGAGCTGG - Intergenic
1185747589 X:2584577-2584599 CGCGCTGCTGCCCGCGGGGCTGG - Intergenic
1188003641 X:25003220-25003242 GGCGCTCCCTTCCGAGGGGGCGG - Intergenic
1188542670 X:31266986-31267008 GGCGCTGCGGGCAGACGGGGCGG + Intronic
1189310231 X:40013359-40013381 TGCACTGAGGCCCGAGGGTGGGG - Intergenic
1190220390 X:48509011-48509033 GGCCTTGCGGCCTGCGGGGGAGG + Intronic
1198268551 X:135032826-135032848 ATCGCGGCGGCTCGAGGGGGAGG - Exonic
1198270421 X:135051644-135051666 ATCGCGGCGGCTCGAGGGGGAGG + Exonic
1200277855 X:154751153-154751175 GCCGCGGCGGCCGGAGGCGGGGG - Intronic