ID: 1003873214

View in Genome Browser
Species Human (GRCh38)
Location 6:10417450-10417472
Sequence TGGCATAAATGCAGCTCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 58}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003873214_1003873219 26 Left 1003873214 6:10417450-10417472 CCAGCCGAGCTGCATTTATGCCA 0: 1
1: 0
2: 0
3: 9
4: 58
Right 1003873219 6:10417499-10417521 ATTGCATGTCAATGCTCCGGCGG No data
1003873214_1003873218 23 Left 1003873214 6:10417450-10417472 CCAGCCGAGCTGCATTTATGCCA 0: 1
1: 0
2: 0
3: 9
4: 58
Right 1003873218 6:10417496-10417518 TTCATTGCATGTCAATGCTCCGG No data
1003873214_1003873221 28 Left 1003873214 6:10417450-10417472 CCAGCCGAGCTGCATTTATGCCA 0: 1
1: 0
2: 0
3: 9
4: 58
Right 1003873221 6:10417501-10417523 TGCATGTCAATGCTCCGGCGGGG 0: 1
1: 0
2: 0
3: 0
4: 22
1003873214_1003873220 27 Left 1003873214 6:10417450-10417472 CCAGCCGAGCTGCATTTATGCCA 0: 1
1: 0
2: 0
3: 9
4: 58
Right 1003873220 6:10417500-10417522 TTGCATGTCAATGCTCCGGCGGG 0: 1
1: 0
2: 0
3: 1
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003873214 Original CRISPR TGGCATAAATGCAGCTCGGC TGG (reversed) Intronic
904636381 1:31884712-31884734 TTGGATAAATGCAGCAGGGCAGG + Intergenic
904899503 1:33845796-33845818 TGGGATAAAAGCAGCTCTGAAGG - Intronic
908361380 1:63371483-63371505 TGGCTTAAATGTAACTCTGCAGG + Intronic
916727995 1:167540451-167540473 TGGAGTAAATGCAGCTCAGCAGG - Intronic
917450111 1:175141017-175141039 TGGCATGCATGCAGCCTGGCAGG + Intronic
917880711 1:179333277-179333299 TTCTATAAATGAAGCTCGGCAGG - Intronic
922802031 1:228368800-228368822 TGGCTGAACTGCAGCTCTGCTGG - Exonic
1073463710 10:103681469-103681491 TGTCAAAAATGCAGATTGGCTGG + Intronic
1074698618 10:116073590-116073612 TGGTATAAAGGCAGCTAGGAGGG + Intronic
1074928202 10:118095253-118095275 TTACATAAATGTAGCTCTGCGGG - Intergenic
1087675397 11:101155655-101155677 TGGCAAAAAAGCAGCTTGGAAGG - Intergenic
1087821610 11:102718808-102718830 TGGAATAAATGCAGCTTTTCTGG - Intronic
1089671343 11:120058977-120058999 TGACATAAAGGCAGCTCTGTGGG + Intergenic
1090551015 11:127819982-127820004 TGGCCTAAATGCACCTCGGTAGG - Intergenic
1096459782 12:51815654-51815676 TGGAATAAGTGCAGGTAGGCAGG - Intergenic
1099990551 12:89716495-89716517 TGTCAAAAATGCAGATCTGCTGG - Intergenic
1102542370 12:113631136-113631158 AGGCATAACTGCAACTAGGCTGG - Intergenic
1104655626 12:130572008-130572030 TGGCATGGATGCAGCTGTGCAGG - Intronic
1106221817 13:27752479-27752501 TGGCCTAAATGCAGCTGCACTGG - Intergenic
1106256916 13:28030559-28030581 TGCCATAAATGCAATACGGCAGG + Intronic
1112655962 13:101452792-101452814 TTGCAGAAGTGCAGCTCGCCCGG + Exonic
1120836035 14:89039215-89039237 TGGCATACATACAGCTAGGCAGG - Intergenic
1121856707 14:97276840-97276862 ATGCATAAATGCAGCCCAGCAGG - Intergenic
1132295527 15:100731522-100731544 TGCCATAAATGCAGCTCTCCGGG - Intergenic
1140237507 16:73172428-73172450 GGCTATAAATACAGCTCGGCTGG - Intergenic
1147791297 17:43015764-43015786 TGGCACAAAAGCAGCACAGCAGG + Exonic
1150551552 17:66215324-66215346 TGGCATAAATGCAAATTGTCAGG + Intronic
1152184276 17:78844359-78844381 TCCCCTAAATGCAGCTGGGCAGG + Intergenic
1153793521 18:8601600-8601622 TGGCTAAAATGCATCTCGGCTGG + Intergenic
1162019024 19:7860371-7860393 TGGCATCCATGCAGCTGGCCCGG - Intronic
942724449 2:178991248-178991270 GGGCATAAATGCAGACTGGCTGG - Intronic
946918976 2:224558494-224558516 TGGCATAAAATCAGGTCGGTTGG - Intronic
1170859850 20:20092541-20092563 TGGCATATATGCAGATCACCTGG + Intronic
1180172548 21:46067302-46067324 TGGCTGAAAAGGAGCTCGGCTGG + Intergenic
1181119275 22:20654750-20654772 TGGCATTAGTGCAGCTGTGCTGG - Intergenic
949538077 3:5011333-5011355 TGGAAAAACTGAAGCTCGGCTGG + Intergenic
949901731 3:8820748-8820770 TGGCTGAGATGCAGCTTGGCAGG + Intronic
953621151 3:44533999-44534021 TGGGAGAAATGAAGCTCTGCAGG - Intergenic
955560936 3:60189984-60190006 TGGCCTAAATGCAGGTCAGATGG - Intronic
960816800 3:121682026-121682048 TGAAATACATGCAGCTAGGCTGG + Intronic
978776101 4:112508513-112508535 TGGCATAAAAGCTTCTCCGCAGG - Intergenic
980340515 4:131539542-131539564 TTGAAGAAATGCAGCTCTGCTGG - Intergenic
982407731 4:155039308-155039330 TTGAATAAATGCAGCTCAGAAGG - Intergenic
985961825 5:3308359-3308381 TGGTGGAAATGCAGCTCGGCAGG + Intergenic
990999161 5:61765675-61765697 TGGCAGAAGTGCAGCTTGGCTGG + Intergenic
1002170532 5:177371820-177371842 TGGCATATAGGCAGGTCTGCTGG + Intronic
1003873214 6:10417450-10417472 TGGCATAAATGCAGCTCGGCTGG - Intronic
1005279599 6:24258875-24258897 TTGCATAAATGAACCTGGGCAGG + Intronic
1010815412 6:80352436-80352458 TGGCAGAAATGGAGCTAGCCTGG - Intergenic
1012526342 6:100182473-100182495 TGGAGCAAATGCAGCTCAGCTGG + Intergenic
1014344747 6:120254092-120254114 AGGCATAAATGCAGGTTTGCTGG + Intergenic
1014805880 6:125828709-125828731 TGGGATACATGCACCTAGGCTGG + Intronic
1017821128 6:158049722-158049744 TGGTATGCATGCAGCTCTGCAGG + Intronic
1018335974 6:162790196-162790218 TGGCATGAATGCAGCGTGGCTGG + Intronic
1019551308 7:1603950-1603972 TTGCAAAAATGCAGCCCGGGAGG + Intergenic
1021433675 7:20589691-20589713 TATCATAAATACAGCTGGGCAGG + Intergenic
1023378189 7:39579183-39579205 GGGCATAAAAGCAGCTCTGCAGG - Intronic
1025614362 7:63105439-63105461 TGGTAAAAATGCAGCTCTTCAGG - Intergenic
1032730027 7:134631603-134631625 TTGGATAGATGCAGCTAGGCTGG + Intergenic
1036141558 8:6213650-6213672 TGGCTGAAATGCTGCTCTGCCGG + Intergenic
1042149445 8:65766240-65766262 TGTCAAAAATTCATCTCGGCTGG - Intronic
1048487320 8:134860357-134860379 TGGCAGTAATGAAGCTTGGCAGG + Intergenic
1057366767 9:94429764-94429786 TGGAGTAAATGCAGCACCGCTGG - Intronic
1057656568 9:96958300-96958322 TGGAGTAAATGCAGCACCGCTGG + Intronic
1058998345 9:110321858-110321880 TGGCTTAACTGCAGCTCTGGAGG + Intronic
1190229901 X:48574232-48574254 AGGGATAAAGGCAGCTCAGCCGG + Intergenic
1192377084 X:70573868-70573890 CAGCATAAATGCAGTTCAGCTGG - Intronic
1195802327 X:108726832-108726854 TGGCACAGAAGCAGCTGGGCCGG - Intronic