ID: 1003889125

View in Genome Browser
Species Human (GRCh38)
Location 6:10548325-10548347
Sequence TGGGAGGCCCAGGAATATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 196}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003889125_1003889131 -4 Left 1003889125 6:10548325-10548347 CCAAGATATTCCTGGGCCTCCCA 0: 1
1: 0
2: 3
3: 19
4: 196
Right 1003889131 6:10548344-10548366 CCCAGAAAGGGCACCACAAAAGG 0: 1
1: 0
2: 1
3: 18
4: 203
1003889125_1003889134 22 Left 1003889125 6:10548325-10548347 CCAAGATATTCCTGGGCCTCCCA 0: 1
1: 0
2: 3
3: 19
4: 196
Right 1003889134 6:10548370-10548392 CTGCAACAAGAGCAAGAGCTTGG 0: 1
1: 0
2: 0
3: 11
4: 211
1003889125_1003889135 23 Left 1003889125 6:10548325-10548347 CCAAGATATTCCTGGGCCTCCCA 0: 1
1: 0
2: 3
3: 19
4: 196
Right 1003889135 6:10548371-10548393 TGCAACAAGAGCAAGAGCTTGGG 0: 1
1: 0
2: 1
3: 21
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003889125 Original CRISPR TGGGAGGCCCAGGAATATCT TGG (reversed) Intronic
900529803 1:3147621-3147643 GGGGAGGCCAAGGCACATCTTGG + Intronic
901254742 1:7813111-7813133 TGGGAGGGCAAGGAATAACAGGG + Intronic
901500433 1:9649586-9649608 TGAGAGGCCCAGGCATCTCTTGG + Intergenic
902231519 1:15030647-15030669 TGGGAGGCCCCGGCACAGCTAGG - Intronic
904577688 1:31515603-31515625 CGGGAGGCCAAGGAAGGTCTTGG + Intergenic
907384245 1:54115732-54115754 GGGGACTCCCAGGAATAACTAGG - Intergenic
908085176 1:60624569-60624591 TTGAAGGCCCAGGAATGTCAGGG + Intergenic
912261428 1:108114634-108114656 TGGCAGACCCAGACATATCTGGG + Intergenic
913445596 1:118947265-118947287 TGGGAGGACCAGGAGGTTCTTGG - Intronic
914800789 1:150960924-150960946 AGGGAGGAACAGGAATATGTGGG - Exonic
915462764 1:156080123-156080145 TGGGAGGCCCCGGAATTTAATGG - Intronic
915607372 1:156961217-156961239 TGGGAGGCCCCAGAGTGTCTGGG - Intronic
915816649 1:158974232-158974254 TGGTTGGCCCAGAAATATATTGG - Intronic
917711063 1:177685769-177685791 GGGGAAACCCAGGAACATCTTGG - Intergenic
921134230 1:212245717-212245739 TGGGATGCCCAGAAATAACTGGG + Intergenic
922875827 1:228939223-228939245 TGTGAGGCGAAGGAATAACTAGG - Intergenic
923475950 1:234331133-234331155 TGGGAGGCCAAGGAAGGTCCAGG + Intergenic
1063529868 10:6820723-6820745 TGAGAGCTCCAGGAACATCTTGG - Intergenic
1064045684 10:12012537-12012559 TGGGAGGCCGAGGTGTACCTCGG + Intronic
1066067697 10:31774316-31774338 TGGGTGGCCCACGAATATACAGG - Intergenic
1068590311 10:58846287-58846309 TGAGAGGGCCAGGAATATTGAGG - Intergenic
1069772468 10:70908353-70908375 AGGGAGTCCGAGGAAAATCTAGG - Intergenic
1069885409 10:71620522-71620544 AGGAATGCCCAGGAGTATCTGGG + Intronic
1071827668 10:89341233-89341255 CTGTAAGCCCAGGAATATCTGGG + Intronic
1071902866 10:90139720-90139742 TGGGAGGACCAGGTTTTTCTGGG + Intergenic
1074343406 10:112656607-112656629 TGGGAGGCCGAGGCAGATCAAGG - Intronic
1074389983 10:113049113-113049135 TGAGCTGCCCAGGAATATCCAGG + Intronic
1075021056 10:118952791-118952813 TGGGAGACACAAGAATGTCTGGG - Intergenic
1077342809 11:2033495-2033517 TGTGAGGCCGGGGAATAGCTGGG + Intergenic
1080438303 11:32267233-32267255 TTGGAGGCCCATGAATCCCTTGG - Intergenic
1084652570 11:70497810-70497832 TGGGAGGCCCAGGACCACCCAGG + Intronic
1087717648 11:101626991-101627013 TGGTAATCCCAGGAATTTCTAGG + Intronic
1089297675 11:117479976-117479998 TAGGAGGCCCTGGAAAAGCTTGG - Intronic
1090206163 11:124885543-124885565 TGGGAGGGCAAGGATTATCCAGG - Intronic
1202825795 11_KI270721v1_random:88684-88706 TGTGAGGCCGGGGAATAGCTGGG + Intergenic
1091821391 12:3478083-3478105 TGGGAGGCCCAGGAAAGGTTTGG + Intronic
1091952721 12:4608334-4608356 TGGGAGGGCCAGGAATGTCTGGG - Intronic
1095673882 12:44893192-44893214 TGGCAGACCCAGGAATTTCCTGG + Intronic
1099941745 12:89197227-89197249 TGGGAGGAGCAGCACTATCTGGG + Intergenic
1100441765 12:94623799-94623821 GGGGAGGACCAGGAAGCTCTGGG + Intronic
1103983995 12:124755144-124755166 TGGGAGGCCCAGGCAGGGCTGGG - Intergenic
1104495033 12:129229024-129229046 TGGGAGGTCCAGGATTCTCCGGG + Intronic
1106217835 13:27719230-27719252 TAGCAGCCCCAGGAATATATTGG + Intergenic
1107880763 13:44830036-44830058 TGTGAGGCCCAGGAATACCTGGG - Intergenic
1108422701 13:50266921-50266943 CTGGAGTCCCAGGAATCTCTGGG + Intronic
1110804612 13:79739662-79739684 TAGGAGGCCCATGGAAATCTTGG - Intergenic
1111102501 13:83606253-83606275 TGGTAGCCCAAGCAATATCTGGG - Intergenic
1112435630 13:99389688-99389710 TTGGAGGCCCCGGAATCTGTGGG - Intergenic
1112805631 13:103161588-103161610 TGGGAGCCCCAGGCATTGCTTGG - Intergenic
1113038171 13:106074350-106074372 GGGGATTCCCAGGAATAACTAGG - Intergenic
1113334198 13:109362699-109362721 CGGGAGGCCCAGGCATTCCTTGG + Intergenic
1117303520 14:54451232-54451254 TGGCAGGCCCAGGCATAGCCTGG - Intergenic
1119178574 14:72588068-72588090 AGGGATTCCCAGGAATATCTGGG + Intergenic
1119442128 14:74635517-74635539 GGGGAGGGCCAGAAATATTTTGG + Intergenic
1121990998 14:98557177-98557199 TGGGAGGCCCAGGCAGACCCAGG - Intergenic
1124035245 15:26048561-26048583 TGAGAGGCCAAGGAAGATGTGGG - Intergenic
1125403757 15:39331854-39331876 TGGTAGGACCAGGCATGTCTGGG + Intergenic
1128772509 15:70292659-70292681 TGAGAGGTACAGGAATATTTGGG + Intergenic
1131662138 15:94528932-94528954 AGGAAGGCCCAGGAAGATCTTGG - Intergenic
1132383626 15:101384271-101384293 TGGGTGGCCCTGGAATGTGTAGG - Intronic
1136276343 16:29181353-29181375 TGGGAGACACAGGAAGCTCTCGG + Intergenic
1138096527 16:54216198-54216220 AGGGAGGCCCAGCAATTTCCAGG + Intergenic
1138330486 16:56211397-56211419 TAGGAGGCCCAGGGAGTTCTGGG - Intronic
1139545840 16:67649181-67649203 TGGGAGGCCCAGGAGTAGGGTGG - Intronic
1141112762 16:81283521-81283543 AGAGGGGCCCAGGAACATCTTGG + Intronic
1141461185 16:84179659-84179681 TGGGAGGTCCAGGAAGCTGTGGG + Exonic
1142080726 16:88147413-88147435 TGGGAGACACAGGAAGCTCTCGG + Intergenic
1142499779 17:325825-325847 TGGGACCCTCAGGGATATCTGGG - Intronic
1142607985 17:1092504-1092526 TGGCAGGCCCTGGAGCATCTTGG - Intronic
1144600378 17:16607622-16607644 TGGGAGTCCCAGGACAATCCAGG - Intergenic
1151634447 17:75335293-75335315 TGGTGGGCCCAGGAAAATGTTGG + Intronic
1152690504 17:81715788-81715810 TGGCAGGCCCTGGCATGTCTGGG - Intronic
1152822134 17:82442792-82442814 CGGCAGGCCCAGGAATGGCTGGG - Exonic
1155549671 18:26951886-26951908 TGGGAGCCAGAGGAAGATCTTGG + Intronic
1156737450 18:40277841-40277863 TGGTAGGCCCAGGCATTTCTTGG - Intergenic
1158562905 18:58530576-58530598 TGGCAGGCTTAGGAATATTTAGG - Intronic
1159073036 18:63647311-63647333 AGTGAGGTCCAGGAAAATCTAGG - Intronic
1159074473 18:63664947-63664969 AGTGAGGTCCAGGAAAATCTAGG - Intronic
1159448093 18:68565201-68565223 TGGGAGTCTCAGGAATTCCTAGG - Intergenic
1159763365 18:72456043-72456065 TGGGATGCCTAGGAAAAACTTGG + Intergenic
1160054016 18:75462670-75462692 TGGGAGGCCCTGGAAGCACTGGG + Intergenic
1160547203 18:79667052-79667074 TGGCAGGCCCAGGAACATTCAGG + Intergenic
1160980542 19:1814719-1814741 TGGGAGGCCCAGGGGTGTTTAGG - Intergenic
1161446472 19:4321905-4321927 TGGGATCCTGAGGAATATCTGGG + Intronic
1161446492 19:4321971-4321993 TGGGATCCCGAGGAGTATCTGGG + Intronic
1161446524 19:4322097-4322119 TGGGATCCTGAGGAATATCTGGG + Intronic
1161446542 19:4322161-4322183 TGGGATCCCGAGGAGTATCTGGG + Intronic
1161446591 19:4322355-4322377 TGGGATCCCGAGGAGTATCTGGG + Intronic
1162344469 19:10111348-10111370 TGGCCGGCCCAGGACTCTCTGGG - Intronic
1162585546 19:11556014-11556036 TGGGTGGCAGAGGGATATCTAGG + Intronic
1163038345 19:14584607-14584629 TGGGAGGTCCAGAAATATGGTGG + Intronic
1163039040 19:14588868-14588890 TGGGAGGTCCAGAAATATGGTGG + Intronic
926013293 2:9425134-9425156 TGGGGGGCCCAGGATGTTCTAGG + Intronic
926420508 2:12692119-12692141 TGGTAGGCCCAGGAGTTCCTTGG + Intergenic
927698523 2:25252798-25252820 TAGGAGGCCCAGGAAGCTGTAGG + Intronic
929574811 2:43044631-43044653 TGGGAAGCCCAGGCATTTCCAGG - Intergenic
929863811 2:45700904-45700926 TGGGAGCCCCAGGCATTCCTTGG - Intronic
930218130 2:48718377-48718399 TTAGAGCCCCAGGAATATTTGGG - Intronic
931132504 2:59352930-59352952 CGGGAGTCCCAGGAAGATTTTGG + Intergenic
931409226 2:62012936-62012958 AGGCAGCCCCAGGAAGATCTGGG + Intronic
931472911 2:62557345-62557367 TATGAGGCCCAGGAACATCTGGG + Intergenic
932607503 2:73175190-73175212 TGTGAGGCCCAGGTTTCTCTGGG + Intergenic
932999317 2:76902244-76902266 AGGTAGGAACAGGAATATCTGGG - Intronic
933202820 2:79470231-79470253 TGAGATGCCCAGCATTATCTGGG - Intronic
934108489 2:88718499-88718521 TAGGAGGCCCAAGTTTATCTTGG - Intronic
936518328 2:113196522-113196544 TCTGGGGCCCAGGAATAACTAGG - Intronic
938760883 2:134424800-134424822 TGGTAGGCCTAGGCATTTCTTGG + Intronic
940909486 2:159197700-159197722 TGGGAGGACCATGAATGCCTAGG + Intronic
944974402 2:205031924-205031946 TGAGAGGCACAGGAATGGCTTGG - Intronic
947275159 2:228382800-228382822 TGGAAGACCCAGGTATATTTTGG - Intergenic
947591167 2:231386843-231386865 TGGGAGGCTCAGGAAGCTCTTGG + Intergenic
948845712 2:240681963-240681985 TGGGAGGACCAAGAATAGCTGGG + Intronic
1171040935 20:21763053-21763075 CGGAAGGCCCAGGCATATCACGG - Intergenic
1172113797 20:32562360-32562382 TGGGGAGCCCAGGAATGTTTGGG - Intronic
1173629907 20:44505111-44505133 TGTGATGCACAGGAATTTCTAGG - Intronic
1173917999 20:46724058-46724080 TGAAAGTCCCAGGAAAATCTGGG - Intronic
1174774698 20:53333003-53333025 AGGCAGCCCCAGGAAGATCTGGG - Intronic
1174963731 20:55186935-55186957 TAGGAGGTACATGAATATCTTGG + Intergenic
1175308220 20:57992617-57992639 TGGAAGGTCCTGGAAAATCTAGG - Intergenic
1175899978 20:62356130-62356152 TGGGATGCACAGGAAGATCCTGG + Intronic
1175921494 20:62452463-62452485 TGGCAGGCCCAGGTGTCTCTCGG + Intergenic
1176294215 21:5062142-5062164 TGGCAGGCCCAGGAACCTCAGGG + Intergenic
1179863044 21:44201506-44201528 TGGCAGGCCCAGGAACCTCAGGG - Intergenic
1182576966 22:31279378-31279400 TGGGAGTCTCAGCAATCTCTTGG + Intronic
1183240429 22:36653693-36653715 TGGAAGGCTCTGGAATCTCTGGG + Intronic
1183384024 22:37504674-37504696 TGGGAGGCCCAGAAGCAACTGGG - Exonic
1184289392 22:43490326-43490348 AGGGAGGCCCAGGCAGAGCTGGG - Intronic
1184658128 22:45952382-45952404 TGGGAGACCCAGGGAGGTCTTGG - Intronic
1184691982 22:46121622-46121644 AGGGAGGCCCAGGTCTCTCTAGG + Intergenic
1184803170 22:46774740-46774762 TCGGGGGCCCAGAAATATCAGGG - Intronic
1185133678 22:49056166-49056188 TGGGAAGCCCAGGATCATCACGG - Intergenic
1185346251 22:50312087-50312109 TGGGAGGCTCAGGCAGACCTAGG + Exonic
949737738 3:7193453-7193475 TGGGAGGCCTAAGAATTTCATGG + Intronic
949869477 3:8575651-8575673 TGGGAGGCTGAGGGATACCTTGG - Intergenic
950883677 3:16344573-16344595 TGGGAGGCCACAGAATACCTTGG - Intronic
952783231 3:37125399-37125421 TGGGAGGCCCAGGAAGGTGTGGG + Intronic
956790344 3:72675330-72675352 CAGGAGGCCCAGGAATCACTCGG - Intergenic
959159716 3:102708339-102708361 TGGTAGGTCAAAGAATATCTGGG + Intergenic
964374821 3:156039276-156039298 TGGTAGTCCCAGGAATTTCTGGG + Intronic
964822696 3:160790770-160790792 TGGGAAGACCAGCAATATCTGGG + Intronic
966626682 3:182024507-182024529 TGGGAGGCCAAGGAAGATTTCGG + Intergenic
968881928 4:3305371-3305393 TGGGAGGGACATGAATCTCTGGG - Intronic
969876508 4:10139538-10139560 TGGGGGTCCCAGGAGCATCTTGG + Intergenic
969896848 4:10313359-10313381 TGGGATGAACAGGAAGATCTGGG + Intergenic
971209531 4:24602455-24602477 TGGGAGCCCCAGGAATAGGGTGG - Intergenic
971390036 4:26177123-26177145 CGGGAGGCTTATGAATATCTAGG - Intronic
972268557 4:37486352-37486374 TGGCAGGCCCAGGATTGACTTGG - Intronic
972817900 4:42665017-42665039 GTGGAGGCCCAGAAATATTTGGG - Intergenic
977209760 4:94205738-94205760 TGGGAGGCCAAGGCAGAGCTGGG - Intergenic
978415299 4:108468599-108468621 AGGGAGGCTCAGGAATATTAGGG - Intergenic
979663176 4:123282116-123282138 TGTGAGGGCAAGGAGTATCTGGG + Intronic
980342767 4:131571895-131571917 TGGGAGGCCAAGGCAGGTCTCGG + Intergenic
982085467 4:151831137-151831159 TGGGACTGGCAGGAATATCTTGG + Intergenic
985776437 5:1846536-1846558 TGGGAGGGCCTGTAATTTCTGGG - Intergenic
985834906 5:2263011-2263033 TGGGATGACCTGGGATATCTTGG - Intergenic
986063047 5:4209657-4209679 TGAGAGGCCCAGCACCATCTTGG - Intergenic
988164562 5:27568910-27568932 TGGGAGTCCCAAGCATGTCTTGG - Intergenic
988481011 5:31630600-31630622 TGAGAGGCCATGGAATATATGGG + Intergenic
993699556 5:91102004-91102026 TGGTAGGCCCAGGGATGGCTGGG - Intronic
994379383 5:99053277-99053299 TGGGAGGCCAAGGATTAGCCTGG + Intergenic
996308212 5:122075416-122075438 TGCCATTCCCAGGAATATCTTGG + Exonic
997467962 5:134100757-134100779 TGGGAGGCACAGCACTTTCTTGG - Intergenic
1003889125 6:10548325-10548347 TGGGAGGCCCAGGAATATCTTGG - Intronic
1005900258 6:30211242-30211264 AGGGAGGCCAAGAGATATCTAGG - Intronic
1007301812 6:40873321-40873343 TGGTAGCCCCAGGAATTCCTTGG + Intergenic
1007370125 6:41421328-41421350 TGGGAGGCCTGGCAGTATCTGGG - Intergenic
1007697663 6:43744013-43744035 TTGGAGGCCCAGGAATAAGCAGG - Intergenic
1008896322 6:56560321-56560343 TGGGGGCCTCAGGAGTATCTGGG + Exonic
1011813888 6:91165853-91165875 TGGAAGGCTCAGGGATATCTAGG + Intergenic
1014303431 6:119711941-119711963 TGGGAGGCCAATCCATATCTAGG + Intergenic
1018610268 6:165641744-165641766 AGTGAGGCTCAGGAACATCTAGG - Intronic
1019350209 7:551030-551052 AGGGAGGCCCAGGCCTACCTGGG - Intronic
1020155525 7:5720641-5720663 TGGGAAACCCAGGGATCTCTGGG + Intronic
1020213834 7:6173939-6173961 TGGGAGGCCCAGGGAGGTGTGGG - Intronic
1021480535 7:21110863-21110885 TCAGAAGCCCAAGAATATCTAGG + Intergenic
1021924730 7:25523342-25523364 TGGGAAGCCCAGAAAGCTCTTGG + Intergenic
1023606723 7:41938016-41938038 TGGGAGGCCAAGGATCACCTGGG - Intergenic
1027251968 7:76404520-76404542 TGGGAGGCCCAGCAACATTTGGG - Intronic
1027347427 7:77275707-77275729 TAGGAGGCCCAGGAAAATCATGG - Intronic
1028737908 7:94238553-94238575 TGGGAGGCACAGGTTTTTCTTGG - Intergenic
1029155501 7:98514593-98514615 TGGGTGTCCCAGAAATATCCTGG + Intergenic
1029319150 7:99742036-99742058 TGGTAGGCCCAGGAACCTGTGGG - Intergenic
1029324112 7:99791006-99791028 TGGTAGGCCCAGGAACCTGTGGG - Intergenic
1029708817 7:102288655-102288677 TGGGAGGCCCAGGATCACTTGGG - Intronic
1030146835 7:106365614-106365636 TTAGAGGCCCTGGAATATGTCGG + Intergenic
1030782537 7:113619037-113619059 CCGGAGCCCCAGGTATATCTTGG - Intergenic
1030928877 7:115497175-115497197 TGGGTGGCCCAGGCATGTCTGGG + Intergenic
1031954748 7:127930792-127930814 TTGGAGGCACAGGCATATCCAGG + Intronic
1034590826 7:152137523-152137545 GGGGAGGCCCAGGAATTTCTAGG + Intronic
1036970064 8:13345468-13345490 AGGGAGTCCCAGGGATCTCTTGG + Intronic
1038720903 8:30034564-30034586 TGGGAGGGCCAGGTTTTTCTTGG - Intergenic
1039473880 8:37829296-37829318 GGGGAGGCCCTGGAAGGTCTCGG - Exonic
1040496001 8:47966123-47966145 GTGGAGGTCCAGGAATAGCTGGG - Intronic
1043421625 8:80104222-80104244 TGGGAGACCAAAGAATAACTTGG - Intronic
1046395260 8:113632691-113632713 TGTGAGGCCCATAAAAATCTTGG - Intergenic
1047399872 8:124537335-124537357 TGGTAGGCAGAGGAATATTTTGG + Intronic
1048050629 8:130812575-130812597 TGTTAGGCCCAGGAGTTTCTTGG - Intronic
1048185754 8:132239083-132239105 TAAGGGGCCCAGGAATTTCTTGG - Intronic
1049092979 8:140530673-140530695 TGGGAGGCCCAAGGATAGCAGGG - Intergenic
1049345190 8:142134947-142134969 TGGGAGGCCCCAGAATGACTAGG + Intergenic
1052916328 9:33926712-33926734 TGGGAAGCCCAGGTCCATCTAGG + Intronic
1057024662 9:91725790-91725812 ACGGAGGCCCAGGAACCTCTGGG - Intronic
1060030089 9:120207069-120207091 TGGGAGGGACAGGAAAATGTTGG - Intergenic
1061070832 9:128309596-128309618 TGGGAGTCCCAGGACCATCCCGG + Exonic
1062327049 9:136017477-136017499 TGGGAGCCCCAGGCATTGCTGGG - Intronic
1062688590 9:137828926-137828948 TGGGAGGGCCAGGCCCATCTGGG - Intronic
1187017885 X:15348595-15348617 TGGGAGGCACTGGAATATCAGGG - Intronic
1187047607 X:15662869-15662891 AGGCAGGCCAAGGAATATGTGGG - Intronic
1187299145 X:18031138-18031160 TGGTAGCCCCAGGCATTTCTTGG - Intergenic
1188022567 X:25174770-25174792 TGGGAGCACCAAGAATTTCTGGG + Intergenic
1190357522 X:49619482-49619504 TGGGAGTCACAGGGAAATCTCGG - Intergenic
1191141323 X:57119299-57119321 CGGAAGGCCCAGGAAAATGTTGG - Intronic
1191142914 X:57135026-57135048 CGGAAGGCCCAGGAAAATGTTGG - Exonic
1197691995 X:129511908-129511930 TGTGAGGTCCAGGAATATTTCGG + Exonic
1197761703 X:130032630-130032652 TGGGAGGGACAGGAATCACTGGG - Intronic
1198235591 X:134733603-134733625 TGGGGGCCTCAGGAATAGCTAGG + Intronic
1198777211 X:140192646-140192668 GGGGAGGCACAGTAATAACTAGG + Intergenic
1200229179 X:154435623-154435645 TGGGAGGCCCAGCAAGAACTGGG - Intronic
1202038628 Y:20660335-20660357 TGGGAGCCACAGGAGTATATTGG + Intergenic