ID: 1003891874

View in Genome Browser
Species Human (GRCh38)
Location 6:10570875-10570897
Sequence TACAAGGCTTAGAAGTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 1, 2: 0, 3: 23, 4: 154}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003891874_1003891884 28 Left 1003891874 6:10570875-10570897 CCTCCCCACTTCTAAGCCTTGTA 0: 1
1: 1
2: 0
3: 23
4: 154
Right 1003891884 6:10570926-10570948 CTTTATGGACTTTCTTTGTCAGG No data
1003891874_1003891878 -10 Left 1003891874 6:10570875-10570897 CCTCCCCACTTCTAAGCCTTGTA 0: 1
1: 1
2: 0
3: 23
4: 154
Right 1003891878 6:10570888-10570910 AAGCCTTGTAGATTTATCTCTGG 0: 1
1: 0
2: 0
3: 9
4: 140
1003891874_1003891880 13 Left 1003891874 6:10570875-10570897 CCTCCCCACTTCTAAGCCTTGTA 0: 1
1: 1
2: 0
3: 23
4: 154
Right 1003891880 6:10570911-10570933 TCCATTATCCTACCACTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003891874 Original CRISPR TACAAGGCTTAGAAGTGGGG AGG (reversed) Intronic
907517385 1:55001151-55001173 TACAAGGCTCAGAGCTGAGGGGG - Intronic
910765058 1:90773649-90773671 TACAAGGATTTTAATTGGGGTGG - Intergenic
912561279 1:110553339-110553361 TTCAAGGGTTAGAAGTAGGAGGG + Intergenic
913500633 1:119469579-119469601 TACAAGACTTGGAGGTGGGGTGG + Intergenic
913511455 1:119566370-119566392 TACAACACTTAGAGGTGGGGTGG + Intergenic
913515692 1:119603707-119603729 TACGAGGCTTGGAGGTGGAGTGG + Intergenic
916299433 1:163257427-163257449 TACAAAGCTCAGATGTAGGGTGG + Intronic
916349803 1:163836422-163836444 CACCAGGCTTGGAGGTGGGGAGG - Intergenic
920868413 1:209772580-209772602 TACAAGACTGAGAAGAGGTGAGG + Intronic
921808667 1:219486459-219486481 CACAGGGCTGAGAAGTGGGTAGG - Intergenic
1063085080 10:2809493-2809515 TACAAGACACTGAAGTGGGGAGG + Intergenic
1063324219 10:5080972-5080994 TAGAGGGCTGAGGAGTGGGGGGG + Intronic
1063752579 10:8967798-8967820 TAGAAGACATAGAACTGGGGTGG - Intergenic
1064003318 10:11681448-11681470 CAAGAGGCTTAGAAGTGGGAAGG - Intergenic
1065054700 10:21833001-21833023 TGAAAGATTTAGAAGTGGGGTGG - Intronic
1066395786 10:35020258-35020280 AAGAATGCTGAGAAGTGGGGAGG + Intronic
1069587917 10:69620893-69620915 TTCAGGGCTTAGAAGAGTGGAGG - Intergenic
1070635480 10:78123262-78123284 TTCAAGGGTTGGAAGTGGGCAGG - Intergenic
1072634627 10:97169881-97169903 CACAAGGCTAATAAGTGGTGGGG + Intronic
1073200698 10:101732801-101732823 TCCCAGGGTTTGAAGTGGGGAGG - Intergenic
1075312745 10:121428549-121428571 GACAAGGCTTAGAGGTAGGTAGG - Intergenic
1080202511 11:29689340-29689362 TACAAGGGTAAAAGGTGGGGTGG + Intergenic
1080495125 11:32810110-32810132 TCCAAGGCTTGGAATTGGAGAGG + Intergenic
1081091250 11:38868459-38868481 TACAAGGAATATAAATGGGGCGG - Intergenic
1082075595 11:47973737-47973759 TACAAAGCCTAGAAGTGAGCTGG - Intergenic
1083985084 11:66209106-66209128 TACAAGGTTTGGAGGCGGGGAGG + Intronic
1089788522 11:120925258-120925280 TACAGGGCTGACAAGTGGGAGGG + Intronic
1090814374 11:130279167-130279189 TCCAAGGCTTAGCATTGTGGAGG - Intronic
1093029764 12:14277455-14277477 TACTAGGCTTAGAAGTTGAGTGG - Intergenic
1093188091 12:16044939-16044961 TAAAATGCTAAGAAATGGGGAGG + Intergenic
1096533317 12:52255425-52255447 CACAAGGCTCAGATCTGGGGAGG + Intronic
1097674830 12:62588879-62588901 AACAAGGTTTAAAAGTAGGGTGG - Intronic
1101698340 12:107148164-107148186 TACAATGTCTAGAAGTGGGGAGG + Intergenic
1103016091 12:117495665-117495687 TGCAAAGCTCAGAAGTGGGGAGG + Intronic
1103127290 12:118434861-118434883 TACAAAGTTTAGAAGTAGGCTGG - Intergenic
1104917806 12:132275006-132275028 TACATGGCTTAGAAGTGAGTTGG - Intronic
1106120663 13:26857923-26857945 TACGTGGCTTAGAAGTGGGCAGG - Intergenic
1109782811 13:67134644-67134666 TATAAGGCTGAGTTGTGGGGTGG + Intronic
1112372701 13:98808398-98808420 TACAAGGCTTAGAATTGCATGGG + Intronic
1113824317 13:113239319-113239341 TACACCGCTTAGAAATTGGGCGG - Intronic
1117071782 14:52064071-52064093 GACAAGGTTTAGAAGAGGGGTGG - Intronic
1117836834 14:59816604-59816626 TTCAGGGATGAGAAGTGGGGAGG + Intronic
1117867971 14:60169234-60169256 TACAAGGCCTTGAGGTGGGCTGG - Intronic
1119942884 14:78659829-78659851 TACAAGGAATTGAAGTGGGCAGG + Intronic
1122388504 14:101364831-101364853 TACAAGGGTTGGAAGGGGAGAGG + Intergenic
1126362654 15:47862216-47862238 AAACAGGCTTAGAAGTGGGCAGG + Intergenic
1128986312 15:72224230-72224252 TACTAGGATTAAAAGTAGGGCGG + Intronic
1131740165 15:95380967-95380989 TACTAGGCTTATAATTGGGGAGG + Intergenic
1133422924 16:5662792-5662814 TACACAACTTAGAAGTGGAGGGG - Intergenic
1135325376 16:21522210-21522232 GCCAAAGCTAAGAAGTGGGGCGG - Intergenic
1136101284 16:27998157-27998179 TGGAAGACTCAGAAGTGGGGAGG - Intronic
1136157373 16:28392179-28392201 AAGAAGCCTTAGAGGTGGGGAGG - Intronic
1136205714 16:28723105-28723127 AAGAAGCCTTAGAGGTGGGGAGG + Intronic
1136336863 16:29615478-29615500 GCCAAAGCTAAGAAGTGGGGCGG - Intergenic
1137674613 16:50298140-50298162 GACAGGGCTTAGGGGTGGGGAGG - Intronic
1139054838 16:63170276-63170298 TAGAAGGACTGGAAGTGGGGAGG + Intergenic
1139583321 16:67885707-67885729 TAAAAGGACTAGAAGTGGGGCGG - Exonic
1143258986 17:5584357-5584379 TGCAAGGCTGAGAAGAGGTGGGG + Exonic
1144805910 17:17967562-17967584 TGCGAGGCTAAGAAGTGTGGTGG - Intronic
1151322445 17:73360008-73360030 TCCCAGGCTGAGAGGTGGGGAGG - Intronic
1155855439 18:30828767-30828789 GACAAGGCTGAGAAGCTGGGAGG + Intergenic
1160452787 18:78977413-78977435 TACAAGGTGTGGACGTGGGGAGG - Intergenic
1163327866 19:16616865-16616887 GACAAGGCCTAGCAGTGGGGGGG - Intronic
1163768414 19:19176459-19176481 TACTCAGCTTAGGAGTGGGGAGG - Intronic
1165308330 19:35015737-35015759 TACAAGGCCTGGGAGTGGGGAGG + Intronic
925014741 2:514256-514278 TACAGTGCTGAGAAGTGGGGAGG + Intergenic
925908088 2:8551504-8551526 ATGAAGGCTTAGAAGTGGGAAGG - Intergenic
927505707 2:23612960-23612982 AAAAAGGCTTAGAAATGGGGTGG + Intronic
929103484 2:38340394-38340416 AATAAGAATTAGAAGTGGGGGGG + Intronic
932207725 2:69898267-69898289 CTCATAGCTTAGAAGTGGGGTGG + Intronic
932828309 2:74961616-74961638 TACTAGGAATAGAAGTGGGGTGG + Intronic
933580297 2:84118116-84118138 TACAAGGCCTAGACCTGGTGTGG - Intergenic
935023509 2:99254549-99254571 TACCAAGCTTAGAGGTGGGATGG - Intronic
936416885 2:112323579-112323601 TATAAAGATTAGAAGTGGAGTGG + Intronic
937968721 2:127534066-127534088 TGCAAGGCTTTGAAGGCGGGTGG - Intergenic
939169354 2:138676470-138676492 TACATGGGTAAGCAGTGGGGAGG - Intronic
945428871 2:209740739-209740761 GACAAGTCATAGAACTGGGGTGG - Intergenic
947302278 2:228701604-228701626 TACAGTGATTTGAAGTGGGGAGG - Intergenic
948800717 2:240432286-240432308 TACAGGGCTTAGCGATGGGGAGG - Intergenic
1170745642 20:19096101-19096123 CACAAGGCTCTCAAGTGGGGAGG - Intergenic
1171820370 20:29831048-29831070 CACCTGCCTTAGAAGTGGGGAGG + Intergenic
1172310730 20:33916206-33916228 TACAAGGCTTACAGCTGGAGGGG - Intergenic
1172433894 20:34914773-34914795 TACTAGGCTGTGATGTGGGGTGG + Intronic
1173016842 20:39233644-39233666 CACAAGGCTGAGAATTTGGGAGG - Intergenic
1173371132 20:42437034-42437056 TACAAGATTTAGAAGAGTGGAGG + Intronic
1174934690 20:54854637-54854659 TAGAAGAATTAGAAGTGGGTAGG + Intergenic
1179307701 21:40169916-40169938 CACCAGGCATAGAAGTGGGGTGG - Intronic
1179536745 21:42057803-42057825 TACAATTCTTAGAAGGGTGGTGG - Intergenic
1180324370 22:11355753-11355775 CACCTGCCTTAGAAGTGGGGAGG + Intergenic
1181727712 22:24823066-24823088 CACAAGGCTTAGAAATGGCAGGG - Intronic
1182275638 22:29186867-29186889 TAGGAGGCTGAGGAGTGGGGTGG + Intergenic
1185020830 22:48373949-48373971 AACAAGGCAGAGAAGAGGGGAGG - Intergenic
1185024277 22:48398729-48398751 TCCAAGGCTGAGCAGTGGGCAGG - Intergenic
951674093 3:25217498-25217520 TTCAAGGATCAGAATTGGGGGGG - Intronic
951953302 3:28225571-28225593 TACAGGACTTAAAAGTGGAGTGG - Intergenic
954413293 3:50380656-50380678 TAGGAGGCTTGGAAATGGGGAGG + Intronic
955796216 3:62639876-62639898 TGCAAGGCTTTGAGGTAGGGAGG - Intronic
956041195 3:65146960-65146982 TAGAAGGAATAGAATTGGGGTGG - Intergenic
956502237 3:69899315-69899337 TACAAGGCTAAAAGGTGGGCAGG + Intronic
957553449 3:81735969-81735991 TAGTAGGCTTAGATGTGGAGTGG - Intronic
959584744 3:108015524-108015546 TCCAGAGCTTAGCAGTGGGGAGG - Intergenic
960164601 3:114387197-114387219 CACAAGGCTTGGAAGTGGGTTGG - Intronic
960417029 3:117397429-117397451 TACATGGCTTGTAAGTGGTGGGG + Intergenic
961187767 3:124930986-124931008 TACAAGGCATAGGGGTGAGGAGG + Intronic
961518579 3:127454126-127454148 TGGAAGGCTGAGAAGTTGGGTGG - Intergenic
962167359 3:133063408-133063430 TTCAAGGCTTAGAGGTAGAGTGG - Intronic
964250622 3:154711860-154711882 TTCAAGACTGAGAAGTGGGCGGG + Intergenic
965937210 3:174129203-174129225 TTCAAGACTTAGAAGTGTTGAGG + Intronic
968622816 4:1611322-1611344 ACCAAGGCTTCGAACTGGGGTGG - Intergenic
969836540 4:9846974-9846996 TACACAGCTTGGAAGTGGAGAGG - Intronic
970910534 4:21269773-21269795 TACATGGCTCAAAAGTTGGGGGG + Intronic
972327382 4:38029521-38029543 TACAAAACTTAGCAGTGTGGTGG - Intronic
973702482 4:53550922-53550944 TTCCAGGCTTTCAAGTGGGGAGG - Intronic
978447702 4:108796208-108796230 AACAAGGCATAGTGGTGGGGTGG + Intergenic
979471742 4:121107160-121107182 TACTAGGCTGGGCAGTGGGGTGG + Intergenic
979915679 4:126430775-126430797 TACCAGAGTTTGAAGTGGGGAGG + Intergenic
980018823 4:127683565-127683587 TAAAAGGCATAGAGGTGAGGAGG - Intronic
980914237 4:139019551-139019573 CACAAGGCTCAGGAGTGGAGAGG - Intronic
984537282 4:180992144-180992166 TTCAAGGCTTAGAAGTGGGGGGG - Intergenic
986021961 5:3812828-3812850 TAGAAGGCTTTGCTGTGGGGTGG + Intergenic
986328175 5:6696097-6696119 TTGAAGACTCAGAAGTGGGGAGG - Intergenic
987223576 5:15816476-15816498 TTGAAGACTCAGAAGTGGGGAGG + Intronic
987313503 5:16702478-16702500 TCCAAGCATTAGAAGTGGGAAGG + Intronic
988348539 5:30070644-30070666 TTGGAGGCTCAGAAGTGGGGAGG - Intergenic
989471205 5:41820851-41820873 AACAAGGCCAAGAAGTGGAGAGG + Intronic
994176471 5:96717400-96717422 TGCAAGGCTCAGAAGTGGAAGGG + Intronic
996354099 5:122577670-122577692 CCCAAGGCTAAGAAGTGGGATGG - Intergenic
997551873 5:134760316-134760338 TGAAAGGCTTAGAGGTGGGAAGG + Intronic
997854606 5:137362226-137362248 TTTAAGGGTTAGAAGGGGGGTGG + Intronic
998361043 5:141587473-141587495 TACAAGGCTTAGAAATGGCAGGG - Intronic
1000189044 5:158890688-158890710 TACCAGGCTTAGCAGCAGGGTGG - Intronic
1001045842 5:168371001-168371023 GATAAGGATTAGAGGTGGGGTGG + Intronic
1003891874 6:10570875-10570897 TACAAGGCTTAGAAGTGGGGAGG - Intronic
1004507215 6:16256577-16256599 TACCAGTGTTAGAAGTGGGTTGG + Intronic
1007267212 6:40605741-40605763 GAAAAGGATCAGAAGTGGGGAGG - Intergenic
1007510518 6:42371100-42371122 TACAAGGCAGTGAAGAGGGGTGG + Intronic
1007854061 6:44835745-44835767 TATAAAGCTTGGGAGTGGGGTGG - Intronic
1013071228 6:106731242-106731264 GCCAAGGCTGAGAAGTGGGGTGG - Intergenic
1013773917 6:113657917-113657939 CACAAGGCATAGAGGTAGGGTGG + Intergenic
1015303324 6:131678761-131678783 CCCAAGGCTTAAAAGTGGTGAGG - Intronic
1015810055 6:137153461-137153483 TACAAGAAGTAGAAGTGGGAGGG + Intronic
1016850145 6:148610682-148610704 AACAAGTCTTAGAAAGGGGGTGG - Intergenic
1020020978 7:4868430-4868452 TACAAGGCAAAGAAGTTGTGAGG - Intronic
1020872965 7:13656613-13656635 CATAAGGTTTAGAAGTGTGGTGG - Intergenic
1021592166 7:22275089-22275111 TACAAGGCGGGGAGGTGGGGAGG - Intronic
1022281324 7:28913059-28913081 TGGAAGACTCAGAAGTGGGGAGG + Intergenic
1023808106 7:43889397-43889419 AGCAAGGCTTAGAAGTGGGCTGG - Intronic
1025020669 7:55476888-55476910 CACAAGGCTCTGAAGTGGGCAGG - Intronic
1028262590 7:88684210-88684232 TGCAAGGATTGGTAGTGGGGTGG - Intergenic
1031448912 7:121890004-121890026 TACAATGTTTAGAAGTTGGGGGG - Intronic
1032776078 7:135114642-135114664 TAGAAGGGTGAGAAGTGGGGTGG - Intronic
1033408127 7:141090351-141090373 TAAAAGACTTAGAAGTAGGCTGG - Intronic
1039792723 8:40888380-40888402 TACAAGCCTCAGAGGTGGGTGGG - Intronic
1041448234 8:57977091-57977113 TCCAAGGGTTACGAGTGGGGAGG - Intergenic
1045356673 8:101395586-101395608 TCCAAAGATTAGAAGTGGGTAGG - Intergenic
1048985652 8:139733431-139733453 TAGCAGGCTAAGATGTGGGGTGG + Intronic
1050119437 9:2293339-2293361 GAAAAGGCTTAGGAGTTGGGAGG - Intergenic
1051310450 9:15765440-15765462 TCCAATGCACAGAAGTGGGGAGG + Intronic
1053338915 9:37304907-37304929 TACAAGGTTTAGAAGTGAAAGGG - Intronic
1054937314 9:70701829-70701851 TACAATGCTTAGAGGAGCGGTGG - Intronic
1054939005 9:70719822-70719844 TACAATGCTTAGAGGAGCGGTGG - Intronic
1056200404 9:84270122-84270144 TACAAGGCTGACAGCTGGGGAGG - Intergenic
1057103281 9:92385888-92385910 CACAAGGATTTGAAGTGAGGGGG - Intronic
1057838616 9:98467224-98467246 TACAGAGCTTAGAAGAGGGGAGG + Intronic
1058971362 9:110086151-110086173 TATAAGACTGAGAAGTGGGAGGG + Intronic
1059708734 9:116847914-116847936 TACAGTGATTAGATGTGGGGCGG + Intronic
1062504313 9:136865622-136865644 TACAGGGCTTAGGACAGGGGTGG - Intronic
1203372028 Un_KI270442v1:316324-316346 CACCTGCCTTAGAAGTGGGGAGG + Intergenic
1186078193 X:5903260-5903282 TAGAAGGCATAGAAGTAGGTGGG + Exonic
1187100939 X:16190978-16191000 GACAAGGCTGAGAAGAGTGGGGG - Intergenic
1189180396 X:38998977-38998999 TACAAGGCATATAAGTGAAGAGG - Intergenic
1189353976 X:40297839-40297861 TACATGGCTTGACAGTGGGGAGG + Intergenic
1189607026 X:42689720-42689742 TTGGAGGCTCAGAAGTGGGGAGG - Intergenic
1192330774 X:70173548-70173570 TAACAGGTTGAGAAGTGGGGAGG - Intergenic
1192440045 X:71167595-71167617 TAGAAGGCGTAGAAGTAGGTAGG - Exonic
1194458991 X:94142664-94142686 TACAAGGCTTAGGAGTGACAAGG - Intergenic
1195011959 X:100741404-100741426 TCCAGGGCTTAGGGGTGGGGTGG - Intergenic
1199245263 X:145597288-145597310 TACAAGGCATACAAATGGGAAGG + Intergenic
1201517149 Y:14830314-14830336 TAGAAGGCATAGAAGTAGGTGGG - Exonic