ID: 1003892514

View in Genome Browser
Species Human (GRCh38)
Location 6:10576038-10576060
Sequence CACACGGACGTGCATGAAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 3, 2: 12, 3: 26, 4: 84}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003892512_1003892514 -5 Left 1003892512 6:10576020-10576042 CCTGTTTGGTGGTCTCTTCACAC 0: 1170
1: 1149
2: 398
3: 94
4: 130
Right 1003892514 6:10576038-10576060 CACACGGACGTGCATGAAAACGG 0: 1
1: 3
2: 12
3: 26
4: 84
1003892509_1003892514 14 Left 1003892509 6:10576001-10576023 CCATGTTGCTCACACAAAGCCTG 0: 1153
1: 517
2: 138
3: 64
4: 213
Right 1003892514 6:10576038-10576060 CACACGGACGTGCATGAAAACGG 0: 1
1: 3
2: 12
3: 26
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003892514 Original CRISPR CACACGGACGTGCATGAAAA CGG Intronic
902687609 1:18089084-18089106 CACAAGGAAGTGCATGAAATGGG + Intergenic
904187241 1:28715070-28715092 CACACAGACGAGCCTGGAAATGG - Intronic
910984802 1:92994997-92995019 CACAAAGACCTGCATTAAAAAGG - Intergenic
912915563 1:113811754-113811776 CACAAGGACAAGCAGGAAAACGG - Exonic
917749400 1:178040655-178040677 CACATGGACGTGCATGACATTGG + Intergenic
918567158 1:185948273-185948295 CACATGGACACGCATGAAATGGG - Intronic
921489713 1:215760234-215760256 CACACTGATGTGCAAGAAGAAGG - Intronic
922153566 1:223024390-223024412 CACACGGATGTGCATGAAAAAGG - Intergenic
924739130 1:246784676-246784698 CACACAGACCTGCAGGAAAGGGG + Intergenic
924812120 1:247412174-247412196 CACAGGCCTGTGCATGAAAAAGG + Intergenic
1062985104 10:1761344-1761366 CACAGGGATAGGCATGAAAAAGG - Intergenic
1064890455 10:20165573-20165595 CACAGGGACATGGATGAAATTGG - Intronic
1064908259 10:20370840-20370862 CACACGGACGCGCATGAAAGTGG - Intergenic
1069627587 10:69877742-69877764 CACACGTACGTGCCTCAAGAGGG + Intronic
1070529043 10:77320250-77320272 CTCTGGGAAGTGCATGAAAAAGG + Intronic
1072659718 10:97356347-97356369 GACACGGAGGTGAATGAACAAGG + Intronic
1072697415 10:97614120-97614142 AACAAGGACGTGCATGTAAAAGG + Intronic
1073753175 10:106552686-106552708 CACACTGAGTTTCATGAAAAAGG - Intergenic
1075040875 10:119105677-119105699 CACACTAACGTGCATTTAAAAGG + Intronic
1076832689 10:133004595-133004617 CACACGGACGCGCATGAAAGAGG + Intergenic
1077308341 11:1877674-1877696 CACACGCACGTGGATGTCAAAGG + Intronic
1077578047 11:3399177-3399199 CACACGGACGCGCATGAAACTGG + Intergenic
1078025629 11:7692646-7692668 CTCATGAATGTGCATGAAAAAGG + Intronic
1079828856 11:25235097-25235119 CACACGCACGTGTATGTAAAGGG + Intergenic
1080025536 11:27610353-27610375 CAAACTGACCTGTATGAAAAAGG + Intergenic
1083614582 11:64019900-64019922 CACGGGGACGTGCATGATGAGGG + Intronic
1084356053 11:68639423-68639445 CACATGGACGCACATGAAAGTGG + Intergenic
1087622836 11:100562423-100562445 CAGAGGGAACTGCATGAAAAGGG - Intergenic
1089470568 11:118717028-118717050 TACACGGACGTGCATGAAAGTGG - Intergenic
1091043770 11:132307203-132307225 CACACACACGTGCATCACAAAGG - Intronic
1096826975 12:54286943-54286965 CACAAGGACGTTCCTGCAAAAGG - Intronic
1098920486 12:76297765-76297787 CACGCGGACGTGCGTGACAATGG + Intergenic
1100860362 12:98799474-98799496 CACACAGCTGTGAATGAAAAAGG - Intronic
1102116204 12:110404974-110404996 CACACGGACGCACATGACAGTGG - Intergenic
1107427750 13:40311230-40311252 CACAGGCACGTGCTTTAAAAAGG - Intergenic
1107767864 13:43756594-43756616 CACACGGATGCACATAAAAATGG - Intronic
1115082102 14:29467024-29467046 CACACGCACGTGCATGTGCATGG - Intergenic
1123923848 15:25089694-25089716 AACATGGACGTGCATCAGAAAGG - Intergenic
1124210488 15:27760190-27760212 CACATGGAACTGAATGAAAATGG + Intronic
1124684742 15:31772353-31772375 CACATAGAGGTGAATGAAAAAGG - Intronic
1124689801 15:31812290-31812312 CACACAGACGTGCAGGAATCAGG + Intronic
1128652143 15:69424891-69424913 CACACGAGCATACATGAAAATGG - Intronic
1131882004 15:96871831-96871853 CACACGGACGCGCATGAAAATGG - Intergenic
1138604608 16:58080750-58080772 CACATGCATGTGCATGGAAAAGG - Intergenic
1141746115 16:85927576-85927598 CACACAGACGTGAATGACATGGG + Intergenic
1143665037 17:8352766-8352788 CACACGGACGCGCATGAAAGCGG - Intergenic
1154307589 18:13241780-13241802 CACAGGGACATGCGTGAAATGGG + Intronic
1159697686 18:71581115-71581137 CACGAGGAGGTGCATTAAAAGGG - Intergenic
1164402412 19:27911125-27911147 AACTCGCACCTGCATGAAAAGGG + Intergenic
1168052145 19:53837332-53837354 CACACGGACGCGCATGAAATGGG + Intergenic
1168131284 19:54321241-54321263 CACACGGAAGCGCATGAAACCGG - Intergenic
927134692 2:20088107-20088129 CACACGGACGCACATGAAACCGG + Intergenic
931248347 2:60509416-60509438 CACACGGACGTCTCAGAAAACGG + Intronic
934095436 2:88598049-88598071 AACAAGGATGTGCTTGAAAAGGG + Intronic
935001757 2:99024412-99024434 CAAACGGAATTGCATCAAAAAGG - Intronic
936991279 2:118369358-118369380 CACACGGACATGCAAGAAAGTGG - Intergenic
938099704 2:128490420-128490442 CACACGGACGTGCTTGACACAGG + Intergenic
939029544 2:137055076-137055098 CACAGGGACGTGGATGAAGCTGG - Intronic
942739320 2:179156034-179156056 CACAGCGACCTGCATGAAATTGG - Intronic
943450685 2:188039125-188039147 CACAGGGACGTGAGTAAAAATGG + Intergenic
943848847 2:192689581-192689603 CACAGGGATGTGCATGCAGAGGG - Intergenic
945429094 2:209743869-209743891 CACACGGACATGGATGAAGATGG - Intergenic
1169923803 20:10761972-10761994 CACACGGACAAGCCTGAACAGGG + Intergenic
1176837164 21:13803859-13803881 CACATGGACATGCGTGACAAAGG + Intergenic
1178312150 21:31538636-31538658 GACATGGACGTGCATGACATTGG - Intronic
1179548821 21:42130251-42130273 CACACGAATGTGCATGCACAAGG + Intronic
1182732781 22:32508485-32508507 CACACAGACGCGCATGAAAGGGG + Intergenic
956904556 3:73752429-73752451 CAGATGGACTTGTATGAAAACGG - Intergenic
957049221 3:75398477-75398499 CACATGGACGTGCATGAAAGTGG + Intergenic
959970285 3:112401531-112401553 CACACGGATGTGCATTAAAGTGG - Intergenic
961881541 3:130064958-130064980 CACGCGGACGCGCATGAAACTGG + Intergenic
963062937 3:141239908-141239930 CACAAGGACTGGCATGAAACAGG + Intronic
964821398 3:160774243-160774265 CTCACAGACTTGCATGAAGAAGG - Intronic
966279964 3:178214642-178214664 CACACGGACACGAGTGAAAATGG + Intergenic
966825063 3:183957670-183957692 CACACGGATCTGCATGTAACCGG - Intronic
967213039 3:187185608-187185630 CACACGGACGCGCATGAAAGTGG + Intergenic
968993854 4:3933064-3933086 CACACGGACGTGCATGAAACTGG + Intergenic
969653515 4:8482393-8482415 CACGCGGACGCTCATGAAAGGGG - Intronic
979147095 4:117257772-117257794 CACAGGGACGCACATGAAACTGG + Intergenic
980389420 4:132123875-132123897 CACAAGGACGCCCATGAAAATGG + Intergenic
980528409 4:134018364-134018386 CACACTGATGCGCATGAAAATGG + Intergenic
980610809 4:135160931-135160953 TACATGCACATGCATGAAAATGG - Intergenic
994776352 5:104039745-104039767 CACACGGACGTGAGTGAAACTGG - Intergenic
996510384 5:124309460-124309482 CACACAGACACACATGAAAACGG + Intergenic
996725936 5:126673464-126673486 CACACGGACACGCATGAAACAGG + Intergenic
1000095693 5:157969101-157969123 CACACGGACGCACGTGACAATGG + Intergenic
1001533915 5:172485150-172485172 CACACGCACGAGCATGCACACGG - Intergenic
1002984137 6:2171770-2171792 CACAAAGACTTCCATGAAAAAGG + Intronic
1003100630 6:3173840-3173862 CACACGGACGCGAGTGAAACTGG + Intergenic
1003892514 6:10576038-10576060 CACACGGACGTGCATGAAAACGG + Intronic
1005891227 6:30140416-30140438 TACAGGGACGTGGATGAAGATGG + Intronic
1010893933 6:81343924-81343946 CACATGGACGCGCATGAAAGTGG - Intergenic
1011254245 6:85404701-85404723 CACACGGACGCGCATGACAGAGG + Intergenic
1012726558 6:102819820-102819842 CACCCAGATGTGCATTAAAATGG + Intergenic
1014476771 6:121882939-121882961 CACAAGGACATGCATAAACATGG + Intergenic
1015267239 6:131301180-131301202 CACACGGACGCGCATGAAACCGG + Intergenic
1016205325 6:141460664-141460686 CACATGGAAGCGCATGAAACTGG + Intergenic
1016249400 6:142021766-142021788 CACACGGACGCGCATGAAACAGG + Intergenic
1016535263 6:145103180-145103202 CACAGGGGCGTGCATGAAAATGG - Intergenic
1017371107 6:153710164-153710186 CACACGCACATGCATGCACATGG + Intergenic
1018165391 6:161089507-161089529 CACACTGACTTTCATCAAAAAGG - Intronic
1019106782 6:169674734-169674756 CACATGGACGCGCATGAAAGAGG - Intronic
1020316476 7:6908976-6908998 CACATGGATGCGCATGAAACTGG + Intergenic
1020441847 7:8225422-8225444 CATAAGGAAGTGCTTGAAAAAGG - Intronic
1022235304 7:28455000-28455022 CTCCCTGACGTGCATGAACACGG + Intronic
1024100994 7:46032796-46032818 CAGAAGGAAGTGCATGGAAATGG + Intergenic
1031776812 7:125915723-125915745 CACAGGGAAGCGCATGAAAGTGG + Intergenic
1033620966 7:143061747-143061769 CACTCTCAAGTGCATGAAAAAGG + Intergenic
1036373914 8:8183844-8183866 CACACGGACGCGCCAGAAAAAGG + Intergenic
1036876989 8:12481797-12481819 CACACGGACGCGCCAGAAAAAGG - Intergenic
1037389771 8:18381065-18381087 GACAGGGACATGGATGAAAACGG + Intergenic
1042207198 8:66341362-66341384 CACAGATACTTGCATGAAAAGGG - Intergenic
1049615191 8:143572852-143572874 CACACGGACGTGCCTACAATGGG + Exonic
1052305333 9:27002282-27002304 CACATGGACCCGCATGAAAGTGG - Intronic
1055810551 9:80143132-80143154 CACACGGACACGCATGAAACTGG + Intergenic
1055882291 9:81015265-81015287 CACACGGACATGAGTGAAACAGG + Intergenic
1059862973 9:118485627-118485649 CACACGGACGCGCATGAAACTGG - Intergenic
1060737343 9:126074444-126074466 CACACGGACGCACATGAAAGTGG - Intergenic
1190925399 X:54899219-54899241 CACATGGACGCCCATGAAAAAGG + Intergenic
1192411492 X:70936964-70936986 CACATGAACGTGCATAAATAGGG - Intergenic
1192640869 X:72860497-72860519 TACATGGACGTGGATGAAAGTGG - Intergenic
1193176377 X:78399984-78400006 CTCACGGAGGGGAATGAAAATGG + Intergenic
1195904397 X:109829486-109829508 CACACCGACGCGCATGAAAGTGG + Intergenic
1201770911 Y:17615826-17615848 CACACGGACCTGTCTGAGAATGG - Intergenic
1201830644 Y:18290160-18290182 CACACGGACCTGTCTGAGAATGG + Intergenic
1201898320 Y:19018075-19018097 CACACACACATACATGAAAAAGG + Intergenic