ID: 1003894238

View in Genome Browser
Species Human (GRCh38)
Location 6:10591665-10591687
Sequence GAGTGGTACTAGCAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 209}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003894238_1003894248 4 Left 1003894238 6:10591665-10591687 CCCTCCTCCTGCTAGTACCACTC 0: 1
1: 0
2: 0
3: 20
4: 209
Right 1003894248 6:10591692-10591714 GCTACTCACATTCATGCACTGGG 0: 1
1: 0
2: 0
3: 6
4: 106
1003894238_1003894247 3 Left 1003894238 6:10591665-10591687 CCCTCCTCCTGCTAGTACCACTC 0: 1
1: 0
2: 0
3: 20
4: 209
Right 1003894247 6:10591691-10591713 GGCTACTCACATTCATGCACTGG 0: 1
1: 0
2: 0
3: 8
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003894238 Original CRISPR GAGTGGTACTAGCAGGAGGA GGG (reversed) Intronic
904103263 1:28052352-28052374 GTGTGGTACTGGCATAAGGATGG + Intronic
904698264 1:32342704-32342726 GAGTGGGGCTAGCAAGGGGAAGG - Intergenic
904962148 1:34342082-34342104 GATTGCTATTTGCAGGAGGAAGG - Intergenic
905768734 1:40624059-40624081 GGGAGGTTCTAGCTGGAGGAGGG - Exonic
906143900 1:43548970-43548992 AAGTGGAACTGGCTGGAGGAAGG - Intronic
906254634 1:44338737-44338759 AAGTGGCAGTAGCAGGAGAATGG + Intronic
907225474 1:52942392-52942414 GAGTGGAACTAACAGGGAGAAGG + Intronic
907352153 1:53841048-53841070 GAGTGGTTCTAACAGCAGCAGGG - Intergenic
913072330 1:115310900-115310922 GAGTGGGAGGAGGAGGAGGAAGG + Intronic
913996444 1:143654664-143654686 GAGTGGGACCAGCAGGAGCCTGG - Intergenic
914376372 1:147077253-147077275 GAGTGGGACCAGCAGGAGCCGGG + Intergenic
914987950 1:152475878-152475900 GGGTTGTCCTAACAGGAGGAGGG + Intergenic
914988408 1:152478724-152478746 GGGGTGCACTAGCAGGAGGAGGG + Intergenic
917564373 1:176196927-176196949 GAGTGAAACCAGCAGGAGGGAGG + Intronic
919549849 1:198971460-198971482 GAGTGGTATGAGCAGGAAAATGG - Intergenic
920249571 1:204614593-204614615 GTGTGTTTCGAGCAGGAGGAAGG - Intergenic
922616013 1:226961583-226961605 GAGGGGTGCTGGCAGGAAGAGGG + Intronic
923257746 1:232235660-232235682 GAGTGATGGTAGCAGGAGGTGGG - Intergenic
923545481 1:234920299-234920321 CAGTGGTGCCAGCTGGAGGAGGG - Intergenic
923701456 1:236303893-236303915 GAGGGCTACTAGCAGTTGGAGGG - Intergenic
924646027 1:245878005-245878027 GAGTGTTCCCAGGAGGAGGAAGG + Intronic
1063416592 10:5877987-5878009 GAGTGGAACATGCAGGATGAGGG + Intronic
1063951377 10:11226385-11226407 AAGTGGTCCTGGCAGGTGGAGGG + Intronic
1065070437 10:22018672-22018694 GTGTGGTACTGGCATAAGGACGG + Intergenic
1065996529 10:31064390-31064412 GAGTGGTGGTAGAAGGTGGAGGG - Intergenic
1067528511 10:47053123-47053145 GAGTGGTACAATTCGGAGGATGG - Intergenic
1067689991 10:48495637-48495659 GAGTCTGACTACCAGGAGGAAGG - Intronic
1067928611 10:50537305-50537327 GAGTAGTCTTAGCAGTAGGAGGG - Intronic
1072306866 10:94116090-94116112 GAGAGGAAGGAGCAGGAGGAAGG - Intronic
1072911808 10:99508872-99508894 GAGTGGGAGAAGGAGGAGGATGG - Intergenic
1074213462 10:111360576-111360598 GGGTGGTAGAGGCAGGAGGAAGG - Intergenic
1074844207 10:117382778-117382800 GTGTGGTACTAGCAGAAGGCTGG - Intergenic
1075024107 10:118971055-118971077 AAGTGGTTCAGGCAGGAGGAGGG - Intergenic
1075244622 10:120810357-120810379 GAGGGAAACTGGCAGGAGGAGGG - Intergenic
1079640180 11:22795403-22795425 GATTGGGAGTACCAGGAGGAGGG + Intronic
1081036356 11:38151044-38151066 ACGTGGTAGGAGCAGGAGGAGGG - Intergenic
1083061436 11:59876948-59876970 GAGTGGGGTTAGCAAGAGGAAGG - Intergenic
1083853367 11:65380251-65380273 GAGGGGTTCAGGCAGGAGGAAGG + Intronic
1085450637 11:76630060-76630082 GAGTGCTGCTGCCAGGAGGAGGG - Intergenic
1087547053 11:99597984-99598006 GAGTGGTATTACAAGAAGGAAGG - Intronic
1088086235 11:105983963-105983985 GAGTGGTATTATCAGGAGATGGG - Intergenic
1089234650 11:117013134-117013156 GAGTGGTAGGAGTAGGGGGAAGG - Intronic
1089304067 11:117515963-117515985 AAGCAGTACTAGCAGGTGGAAGG + Intronic
1089618355 11:119707924-119707946 CAGTGGTAGTGGCAAGAGGAAGG + Intronic
1090360157 11:126166478-126166500 GCATGGGACTTGCAGGAGGAGGG - Intergenic
1091101911 11:132882384-132882406 GAGTGGTTCTAGAACCAGGAAGG + Intronic
1091635564 12:2194144-2194166 GAGAAGCACTAGGAGGAGGAGGG - Intronic
1092943243 12:13429677-13429699 GAGGGGTCCTAGCAGGAAAAGGG + Intergenic
1095161854 12:38927260-38927282 GAATGGTACAAGCCGAAGGAGGG - Intergenic
1097069771 12:56346441-56346463 GGGTGCTACTACCAGGAGAAAGG - Exonic
1097384640 12:58934754-58934776 GAGTGGGAAGAGCAGGAGGAGGG - Intergenic
1097936705 12:65260512-65260534 GTGTGGTATTAGCATAAGGATGG - Intergenic
1098097862 12:66979260-66979282 TAATGGTACTTGCAGGATGACGG - Intergenic
1098520058 12:71425293-71425315 GAGTGGTAGAAGCAGGAGTCAGG - Intronic
1098693821 12:73526429-73526451 AAGTGGTACTAGCTAGTGGAAGG + Intergenic
1098917576 12:76273648-76273670 GAGTGGTACTAGCAGTTTGAAGG - Intergenic
1100252370 12:92840732-92840754 GTGTGGTACTAGCATAAAGATGG + Intronic
1101624540 12:106426110-106426132 CAGTGCTGCTGGCAGGAGGAGGG - Intronic
1101870382 12:108560973-108560995 GCGTGGGATCAGCAGGAGGAAGG - Exonic
1102271795 12:111542805-111542827 GTGTGGTACTAGTAAGAGTAAGG - Intronic
1102422051 12:112811417-112811439 GAGTGTTCCTAGGAGCAGGAAGG - Intronic
1103211092 12:119166968-119166990 GAGTGGTACTAGGAGGACTGTGG + Intergenic
1108045174 13:46377044-46377066 GAGTGGAACTAGTAAGAGAAAGG - Intronic
1108333031 13:49409488-49409510 GAGTGGGACAGACAGGAGGAAGG + Intronic
1109645113 13:65244098-65244120 GTTTGCTTCTAGCAGGAGGATGG - Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1113258599 13:108534726-108534748 GAGTTGTAGTAGCAGTAGTAAGG - Intergenic
1113729023 13:112626404-112626426 CTGTGTGACTAGCAGGAGGAGGG - Intergenic
1114695911 14:24627685-24627707 GAGTGGTACTGGGAGAAGCATGG + Intergenic
1116194302 14:41702702-41702724 GAGAGGCCCAAGCAGGAGGATGG - Intronic
1116840021 14:49810514-49810536 CACTGGTACTGGCATGAGGATGG - Intronic
1117006536 14:51426362-51426384 GAGTGGGGCTTGCAGGTGGATGG - Intergenic
1118766798 14:68915349-68915371 GAGTGAAACTGGCAGGAGGCAGG - Intronic
1120860192 14:89248071-89248093 GAGGGGTTGGAGCAGGAGGAAGG - Intronic
1121819077 14:96951409-96951431 GAGTGTTACCAGCAGAGGGAAGG + Intergenic
1124047253 15:26161710-26161732 CAGCAGTACCAGCAGGAGGAAGG - Intergenic
1124077814 15:26462326-26462348 TAGTGGTACTAGCAGCAGGGTGG - Intergenic
1124440237 15:29680417-29680439 GAGTGATAGTACCAGGAGGCGGG - Intergenic
1126860698 15:52879958-52879980 AAGAGGGACCAGCAGGAGGATGG - Intergenic
1129889378 15:79061044-79061066 GAGAGTTACTAGCTTGAGGATGG + Intronic
1130586863 15:85189948-85189970 CAGCAGTGCTAGCAGGAGGAGGG + Intergenic
1132475159 16:131706-131728 GAGTGGTACTTGCTGAAGGCTGG + Intronic
1133011414 16:2914042-2914064 GAGTGATAGGAGCGGGAGGAGGG - Intronic
1135466740 16:22693130-22693152 GAGTGGGGCTACCAGGAGGCAGG + Intergenic
1135605310 16:23819393-23819415 GAGGGGTACTAGCCTGAGGATGG - Intergenic
1135839985 16:25867283-25867305 GAGAGGGACTGGCAGGAGGAGGG + Intronic
1136510850 16:30737540-30737562 GAGGGGTACAGGCAGGAGGAGGG - Exonic
1138514909 16:57530692-57530714 GGGTGGGACTGGCAGGAGGGAGG - Intronic
1141178172 16:81734372-81734394 GAGTGTGAGGAGCAGGAGGAGGG + Intergenic
1141672236 16:85498121-85498143 GAGTGGAGCTGGCGGGAGGAGGG + Intergenic
1142186770 16:88698433-88698455 GAGGGGCCCGAGCAGGAGGAGGG + Intronic
1142265163 16:89061097-89061119 GAGGGGGATTTGCAGGAGGAGGG - Intergenic
1145780929 17:27562600-27562622 AGGTGGTCCTAGGAGGAGGAGGG - Intronic
1146287568 17:31584538-31584560 GAGTGTTACTATTAGGAGAAAGG - Intergenic
1151308383 17:73278717-73278739 GAGTGGTGCTTGCAGGCAGATGG - Intergenic
1151522807 17:74642505-74642527 GGGTGGTGCCAGCAGGAGAAAGG - Intergenic
1156569345 18:38235262-38235284 GAGAGGTGCTAGAAGGAGTAAGG - Intergenic
1157107369 18:44787167-44787189 GAGTGGAACTAGGATGAGAAAGG + Intronic
1157883310 18:51342378-51342400 GAGAGGTAACAGCAGCAGGAAGG + Intergenic
1158262561 18:55624914-55624936 GACTGGTACTAGGATGAGGAAGG - Intronic
1159468564 18:68818528-68818550 GAGTGGTAATGACAGGAGGAAGG - Intronic
1162516096 19:11148750-11148772 GCGTGGTCCCAGCAGGAGAATGG - Intronic
1163044726 19:14631870-14631892 AAGTGGAAGTAGCAGGAAGAGGG + Intronic
1165114498 19:33521078-33521100 GAGTGGTCGTAGTGGGAGGAAGG - Intronic
1165149823 19:33753872-33753894 GAGGGGTAGTGGTAGGAGGATGG - Intronic
1165398501 19:35582001-35582023 GTGTGGTACTGGCATAAGGATGG + Intergenic
1167738595 19:51311433-51311455 GATTGGGACTTGAAGGAGGAGGG + Intergenic
1168578632 19:57534969-57534991 GAGGTGAACTAGCAGGAGCATGG + Intronic
924985266 2:264485-264507 GAGGGGTACCTGGAGGAGGAAGG - Intronic
926634201 2:15163287-15163309 GAGTGGGACTAGAAGGGAGAAGG + Intergenic
929121128 2:38484857-38484879 GAGTGGTCCCTTCAGGAGGAAGG - Intergenic
929707051 2:44224571-44224593 GAGTAGTAATAGGAGGGGGAAGG - Intronic
930674346 2:54184257-54184279 GAGTGGTATTAGCAAGAGAATGG + Intronic
933895425 2:86806708-86806730 GAGTGGTGCAAGCCGGAGGATGG - Intronic
935679617 2:105624691-105624713 GAGAGGTGGCAGCAGGAGGAGGG - Intergenic
937323001 2:120972087-120972109 GCCTGGTCCTAGCTGGAGGAAGG - Intronic
938059643 2:128242265-128242287 TTGTGTTTCTAGCAGGAGGAGGG + Intronic
938990451 2:136622969-136622991 GAGGGGTACTGGCAAGAGCAGGG + Intergenic
939020832 2:136956553-136956575 GAGTGGCAGTAGCATGAGCATGG - Intronic
947473439 2:230418817-230418839 GCGTGGTACTGGCATAAGGAGGG - Intronic
1169235164 20:3924803-3924825 CTGTGGTACAAGCAGGAGGATGG - Intronic
1170242336 20:14181645-14181667 GACTGCTACGAGCTGGAGGAGGG - Intronic
1173441304 20:43078910-43078932 GTCTGGTGCTAGCAGCAGGATGG - Intronic
1173960890 20:47071797-47071819 GAGAGGAACATGCAGGAGGAGGG - Intronic
1174933429 20:54841356-54841378 GAATGGTAATAACAGAAGGATGG - Intergenic
1177758288 21:25373643-25373665 GAGTGGGAGGAGGAGGAGGAGGG - Intergenic
1179385033 21:40933670-40933692 GAATGGAACTACCAGCAGGAGGG + Intergenic
1179573895 21:42294799-42294821 AGGTGGAACTAGCAGGAAGATGG - Intronic
1179681223 21:43022474-43022496 GAGTGGTCCTGGGAGGAGAAGGG + Intronic
949221262 3:1636848-1636870 GAGTTGTATTCCCAGGAGGATGG + Intergenic
950307399 3:11927075-11927097 GTGTGGTACTGGCATAAGGACGG - Intergenic
951216204 3:20027660-20027682 GAGTGGGAAAAGAAGGAGGAAGG + Intergenic
952686480 3:36155049-36155071 CTGTGGTTCTGGCAGGAGGAAGG + Intergenic
953904785 3:46863184-46863206 GAGTGGACCTAGCAAGAGGCAGG - Intronic
954868844 3:53751583-53751605 GAGTGGTGCCAGCAGCAGGAAGG + Intronic
955946752 3:64202096-64202118 GTGTGGTACTGGCACAAGGAGGG - Intronic
956021886 3:64941847-64941869 GAGTGTGAATAGCAGGAGGTGGG + Intergenic
961906270 3:130265773-130265795 GAGTGGTAATAGAAGGCTGATGG + Intergenic
962428895 3:135301411-135301433 GATTTCTGCTAGCAGGAGGACGG - Intergenic
964784297 3:160377458-160377480 GAGCAGTACTTGCAGGAAGATGG - Exonic
968449468 4:668505-668527 TAGTGGTACTAGCATGGGGTAGG - Intronic
968449483 4:668561-668583 TAGTGGTACTAGCATGGGGTAGG - Intronic
972591375 4:40491102-40491124 GCGTGGTACTGGCATAAGGATGG + Intronic
976426533 4:84910444-84910466 GTATGGTACTAGCATAAGGATGG + Intronic
976703083 4:87992357-87992379 GGGTGGTACTGGCAGAAGAATGG + Intergenic
977354108 4:95924089-95924111 TAGTGACTCTAGCAGGAGGAAGG + Intergenic
977380833 4:96271485-96271507 AAGTTGTACTTGCAGGAGGCTGG + Intergenic
977724848 4:100284213-100284235 GAGTGGGACTGGCAGGAGCCGGG + Intergenic
979282638 4:118884926-118884948 GAGTGATAGTAGCACGTGGAAGG + Intronic
979304257 4:119124389-119124411 GGGTGGTATTAGTAAGAGGAAGG - Intergenic
979538664 4:121854103-121854125 GAGTGATGGTAGAAGGAGGAGGG - Intronic
980420504 4:132553555-132553577 GAGGGGTACTAAGAGGAGGCTGG - Intergenic
981107966 4:140902968-140902990 CAGTGGTGCTAGAAGGAGAAAGG + Intronic
982169090 4:152643933-152643955 GAGTGGGAGGAGCAGGAGGAAGG - Intronic
983207725 4:164928863-164928885 GACTGGTATTACTAGGAGGAAGG - Intergenic
987562713 5:19544775-19544797 AACTTGTCCTAGCAGGAGGAAGG + Intronic
988215591 5:28268163-28268185 GCGTGGCCCAAGCAGGAGGAAGG - Intergenic
988483086 5:31645885-31645907 GAGTTGTACTGGGAGGAGGGTGG + Intronic
988624512 5:32858730-32858752 GAGGACTACTAGAAGGAGGAAGG - Intergenic
990616219 5:57511204-57511226 GAGTGGTGAAAGGAGGAGGAAGG + Intergenic
992611551 5:78512463-78512485 GTTTGGTACTATCTGGAGGAGGG - Intronic
996516325 5:124373404-124373426 GAGTGGTAATAGAAAGAAGATGG - Intergenic
996747871 5:126860969-126860991 GAGTTGTACTGGGATGAGGAGGG + Intergenic
997199589 5:132001774-132001796 GAGAGGTACTGTCATGAGGATGG - Intronic
998168651 5:139859178-139859200 GGGTGGTAGTAGCAGGTGGCAGG + Intronic
998845838 5:146308943-146308965 GAGAGATACTAGCAGCAGGCAGG + Intronic
1001616967 5:173050276-173050298 GAGAGGCAGTACCAGGAGGAAGG - Intergenic
1001791852 5:174464502-174464524 GAGTGGTTCTGGAAGGAGGAAGG - Intergenic
1002715751 5:181225868-181225890 CAGTGGGACCAGGAGGAGGAGGG + Intronic
1003732574 6:8842272-8842294 GAGTGGTCATAGCATGAGGTAGG - Intergenic
1003894238 6:10591665-10591687 GAGTGGTACTAGCAGGAGGAGGG - Intronic
1006824328 6:36923321-36923343 GAGGGGAAATAGCAAGAGGAAGG - Intronic
1007198266 6:40082438-40082460 GAGTGGTCCCAGGTGGAGGAGGG - Intergenic
1007734198 6:43970549-43970571 GGCTGGAAGTAGCAGGAGGAGGG - Intergenic
1007831062 6:44638774-44638796 GACTGGTCTAAGCAGGAGGAAGG + Intergenic
1008290829 6:49713776-49713798 GCGCCGTACTAGGAGGAGGAGGG + Intergenic
1008399735 6:51050847-51050869 GTCTGTGACTAGCAGGAGGAAGG + Intergenic
1011303382 6:85899907-85899929 GAAAGGTACTTGCAAGAGGAGGG + Intergenic
1012332600 6:98011631-98011653 TTGTGCTTCTAGCAGGAGGAGGG - Intergenic
1015826359 6:137316804-137316826 CAGTGGTTCTGGCAGGAGGTAGG - Intergenic
1017462971 6:154668478-154668500 GTGTGGTATTAGCACGAGGATGG + Intergenic
1018244661 6:161811389-161811411 GTGTGGTACTGGCATCAGGATGG + Intronic
1022286681 7:28960360-28960382 GAGTGGTATTACCTAGAGGAAGG + Intergenic
1022524923 7:31030702-31030724 GAGTGGTACTGGCAGCTGGTGGG + Intergenic
1023145694 7:37148793-37148815 GAGTGGTACAAGGAGGAGCTGGG - Intronic
1023348598 7:39296684-39296706 GGGTGGCACTGGCAGGAGGGTGG - Intronic
1027190066 7:75991345-75991367 GAGAGGTAGCAGCAGGTGGACGG - Intronic
1027193728 7:76013647-76013669 GAGTGGGAGAAACAGGAGGATGG - Intronic
1030713513 7:112782452-112782474 GAAAGGAGCTAGCAGGAGGAGGG + Intronic
1032755132 7:134882962-134882984 GAGTGGTACTATTTGGAAGAAGG + Intronic
1034907756 7:154965563-154965585 GAGTGGGCCTAGGAGGAGGAGGG - Intronic
1039088763 8:33806028-33806050 GAGTGGGACAAGGAGGAAGAGGG - Intergenic
1039592483 8:38761098-38761120 AAGTTGTACTACCAAGAGGATGG + Intronic
1040056698 8:43064699-43064721 GAGTGGGACTGGCAGTGGGAGGG - Intronic
1041097275 8:54362119-54362141 CAGTGGTGCTAGCAGGAGCTTGG + Intergenic
1041757431 8:61330033-61330055 GAGTGGTACCAGCTGCAGGTGGG - Intronic
1046100521 8:109609128-109609150 GAGAGGTAATTGCAGGAGGAGGG - Intronic
1046608727 8:116400716-116400738 CTGTGGTATTAGCAGAAGGATGG + Intergenic
1050348121 9:4713858-4713880 GACGGGTATTAGCAAGAGGAAGG - Intronic
1050836672 9:10089492-10089514 GAGTGGGATTAGCAACAGGAAGG + Intronic
1051728860 9:20117191-20117213 GTGGGGTATTAGCAGAAGGAAGG + Intergenic
1052193856 9:25688758-25688780 GAGTGGTACTGCCCTGAGGAAGG - Intergenic
1056775438 9:89508858-89508880 GAGGTGGACTAGCAGCAGGAAGG - Intergenic
1058579687 9:106441415-106441437 GAGAGGAAGTAGGAGGAGGAAGG + Intergenic
1061573735 9:131493386-131493408 GAGCGGAACTGGAAGGAGGAAGG + Intronic
1061670559 9:132185872-132185894 GAGTGGGAGGAGGAGGAGGAGGG + Intronic
1203779992 EBV:95963-95985 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203779998 EBV:95981-96003 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780016 EBV:96026-96048 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780022 EBV:96044-96066 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780036 EBV:96080-96102 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780042 EBV:96098-96120 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780052 EBV:96125-96147 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780066 EBV:96161-96183 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780072 EBV:96179-96201 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780082 EBV:96206-96228 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780096 EBV:96242-96264 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780120 EBV:96308-96330 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780176 EBV:96461-96483 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780186 EBV:96488-96510 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1203780223 EBV:96587-96609 GAGGGGCAGGAGCAGGAGGAGGG + Intergenic
1185575449 X:1168882-1168904 GAATGGTACTAGAAAGAGAAGGG + Intergenic
1185934766 X:4243886-4243908 GACTGGTACTGGCTGGGGGATGG - Intergenic
1190586308 X:51946534-51946556 GAATGGTAGTTACAGGAGGAGGG + Intergenic
1192099980 X:68254177-68254199 AAGTGGTACAAGCAGCATGAAGG + Intronic
1192857363 X:75026364-75026386 GTGTGGTACTATCAAAAGGATGG - Intergenic
1194318474 X:92411949-92411971 GAGTGGGAGGAGGAGGAGGAGGG + Intronic
1194418292 X:93639999-93640021 GTGTGGTACTAGCATGAAGAAGG + Intergenic
1198186626 X:134259636-134259658 GACGTGTACTAGCAGGAGAAAGG - Intergenic
1199403131 X:147424066-147424088 GAGTGGTATAAGCAAGAGGATGG + Intergenic