ID: 1003894733

View in Genome Browser
Species Human (GRCh38)
Location 6:10596553-10596575
Sequence CCGTTTTTCTGGAGGAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 271}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003894726_1003894733 16 Left 1003894726 6:10596514-10596536 CCATCTCAAAAAAAAAAAAGATT 0: 63
1: 2292
2: 13247
3: 119803
4: 93034
Right 1003894733 6:10596553-10596575 CCGTTTTTCTGGAGGAAAAATGG 0: 1
1: 0
2: 3
3: 17
4: 271
1003894728_1003894733 -8 Left 1003894728 6:10596538-10596560 CCATTCTCTTGGCCTCCGTTTTT 0: 1
1: 0
2: 8
3: 84
4: 687
Right 1003894733 6:10596553-10596575 CCGTTTTTCTGGAGGAAAAATGG 0: 1
1: 0
2: 3
3: 17
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003894733 Original CRISPR CCGTTTTTCTGGAGGAAAAA TGG Intronic
900831789 1:4970649-4970671 TCGTTTTTCTGAAGGGAAAGAGG - Intergenic
902607723 1:17578117-17578139 CCATTTTACAGAAGGAAAAAGGG - Intronic
902915824 1:19638674-19638696 CCTTTTTCATAGAGGAAAAAAGG - Intronic
904337889 1:29809994-29810016 CATGTTTTCTGGAGGAATAATGG - Intergenic
909309588 1:74129629-74129651 TCCTTCTTCTCGAGGAAAAATGG - Intronic
910238113 1:85056975-85056997 CTGTTTTTCTAGTGGAAATAGGG + Intronic
911461546 1:98197441-98197463 GGGTATTTATGGAGGAAAAAAGG - Intergenic
912360642 1:109091824-109091846 CAGTTTTACTGGAGGAAGAGAGG + Intronic
913270661 1:117090033-117090055 CCTTTTTTGTTGAGGAAGAAGGG - Exonic
914838521 1:151228449-151228471 CTGTCTTTGTGGAGGAAAAGGGG - Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918807890 1:189073075-189073097 TCTTTGTTCTGCAGGAAAAAAGG + Intergenic
918908278 1:190528784-190528806 CAGTTTTCCAGCAGGAAAAAGGG - Intergenic
919066739 1:192701096-192701118 AGTTTTTTCTGGAGGAAATAAGG + Intergenic
919613922 1:199781450-199781472 TGGTTTTGCTGGAGGACAAATGG - Intergenic
919647369 1:200108448-200108470 CCATTTTGCAGGTGGAAAAATGG - Intronic
919847919 1:201653262-201653284 CCCTTTTCCTGGAGGACAGAAGG - Intronic
920125263 1:203689259-203689281 CCTTTTGTGTGAAGGAAAAAGGG + Intronic
921875053 1:220186440-220186462 GCGTGTTTGTGGAGGAGAAATGG + Intronic
923825506 1:237495216-237495238 CCATTTTCCAGGAGGATAAATGG + Intronic
1062805838 10:418771-418793 CCGTTATTCAGCAGCAAAAACGG + Intronic
1063597146 10:7445759-7445781 CTGTTGTTCTAGAAGAAAAAAGG - Intergenic
1064770418 10:18717198-18717220 CCCTATATCTGGAGGAAAAAAGG - Intergenic
1065791812 10:29267429-29267451 CCTTTTTTGAGGGGGAAAAAGGG - Intergenic
1066229748 10:33420817-33420839 TCCTTTTTCTGGAGAAACAAAGG + Intergenic
1069162435 10:65108277-65108299 CACTTTTTCTGGAGTCAAAATGG + Intergenic
1071595345 10:86918338-86918360 ACCTTTTTCTGGAGGGAAGAGGG + Intronic
1071836715 10:89425457-89425479 CTGTTTTTCAGAAAGAAAAAGGG + Intergenic
1072886355 10:99278615-99278637 CTGTTTATCAGGATGAAAAAAGG + Intergenic
1073840347 10:107491812-107491834 GAGTTTAACTGGAGGAAAAATGG + Intergenic
1074369850 10:112891468-112891490 CCGTTTCCCTTGAGAAAAAAAGG - Intergenic
1074674325 10:115831114-115831136 CCGTGTTTCTGGAAGAACAAGGG - Intronic
1074731608 10:116383378-116383400 AAGTTTTTCTGGATGACAAAAGG - Intergenic
1075160326 10:120018797-120018819 CCCTTTTTCTTGATAAAAAATGG + Intergenic
1075259127 10:120947911-120947933 CCGTGTGGCTGGAGCAAAAAAGG - Intergenic
1075300343 10:121316704-121316726 GAATTTTTCTGTAGGAAAAATGG + Intergenic
1076002695 10:126924637-126924659 CTGTTCTTCTGGAGGCAACACGG - Intronic
1076360933 10:129888531-129888553 GCGCTTTTGTGGAGGAAAGAAGG + Intronic
1076686935 10:132202420-132202442 CCGTTTCTCTCGAGGACAAAGGG - Intronic
1077941091 11:6844321-6844343 ACCTGTTTCTGGAGGAAAGAAGG - Intergenic
1079437925 11:20476488-20476510 CTGGGTTTCTGGAGGAAAAATGG + Intronic
1079948536 11:26772824-26772846 CAGTTTTTCTGGCTGTAAAATGG - Intergenic
1080002800 11:27369838-27369860 CAGTTTCTCTGGATGAAAAATGG - Intronic
1080373593 11:31681446-31681468 TCACTTTTCTGGTGGAAAAATGG - Intronic
1082131391 11:48493887-48493909 CAGTCTTTCAGGGGGAAAAAAGG - Intergenic
1082564885 11:54664764-54664786 CAGTCTTTCAGGGGGAAAAAAGG - Intergenic
1083300317 11:61736637-61736659 CCGTTTGTCAGAAGGAAACATGG + Intronic
1083820009 11:65164603-65164625 CCTTGTTTCAGGGGGAAAAAAGG - Intergenic
1084253718 11:67923425-67923447 CAGTTTGTTTGGAGGCAAAATGG - Intergenic
1087446547 11:98262035-98262057 AAGTTTTTATGGAGCAAAAATGG + Intergenic
1087500593 11:98948137-98948159 CTGTTTTTTTGGAGGAGAAATGG - Intergenic
1087599628 11:100296717-100296739 CAGTTTTTCTGGTGTATAAAAGG + Intronic
1088029656 11:105231128-105231150 CTGTCTTCCTGGAGGCAAAAAGG - Intergenic
1088059165 11:105624709-105624731 ATGTTTTTGGGGAGGAAAAAAGG - Intronic
1088726083 11:112636468-112636490 CTGCTTTTATGAAGGAAAAAAGG + Intergenic
1089431796 11:118431009-118431031 CTTTTTTTCTGGGGAAAAAAGGG - Intronic
1090821066 11:130342261-130342283 ACATTTTACTGGAGGGAAAATGG + Intergenic
1091941341 12:4485919-4485941 CCATTTTCCTGTAGGAAAACAGG + Intergenic
1092423791 12:8356812-8356834 CAGTTTGTTTGGAGGCAAAATGG - Intergenic
1092567262 12:9680507-9680529 GCATTGTTTTGGAGGAAAAAAGG - Intronic
1093578967 12:20766456-20766478 CAGTTTTTGGGCAGGAAAAATGG - Intergenic
1094323369 12:29209556-29209578 CAGTTCTGCTGGAGGAAAACTGG + Intronic
1094530095 12:31266152-31266174 CCATTTTTCGGAAAGAAAAAGGG + Intergenic
1094770605 12:33653857-33653879 ATGGTTTTCTGAAGGAAAAAAGG + Intergenic
1095310403 12:40691924-40691946 CAGTTTTTCTTGAGAAAAGACGG - Intergenic
1096861693 12:54533399-54533421 GAGGTTTTCTGGAGGAAGAAAGG - Intronic
1099150789 12:79110395-79110417 CCCTATTTTAGGAGGAAAAAAGG - Intronic
1100144181 12:91657110-91657132 CCATGTTACTTGAGGAAAAACGG + Intergenic
1101443376 12:104719917-104719939 CCCATTTCCTGGAGGAAAAGCGG + Intronic
1101580001 12:106034120-106034142 CAGTCTTTCTGGAGGAAATTAGG + Intergenic
1102601073 12:114031033-114031055 CCATTTTACAGGAGAAAAAAAGG + Intergenic
1103076195 12:117984650-117984672 CCTTTTCTCTGGAAAAAAAATGG + Intergenic
1103242812 12:119429057-119429079 ACGTGTGTCTGGAGTAAAAAAGG - Intronic
1107347739 13:39480656-39480678 AAGTTTTTCTTGAGTAAAAAAGG - Intronic
1108789652 13:53952256-53952278 ATGTATTTCTAGAGGAAAAATGG - Intergenic
1109268252 13:60225307-60225329 CTGTGTATCTGGAGGAAGAAAGG - Intergenic
1110499696 13:76212868-76212890 CTGTTTTTGTGGATGAAGAATGG - Intergenic
1112234644 13:97624480-97624502 CCTTCTTCCTGGAGGAAAATGGG + Intergenic
1112358828 13:98697938-98697960 TGGTTTTTCAGGAGGAAAAGTGG + Intronic
1112953132 13:105027639-105027661 CCTTTTTTATAGAAGAAAAATGG - Intergenic
1113148005 13:107230209-107230231 CCATTTTTATGGACCAAAAATGG - Intronic
1113403521 13:110017692-110017714 CAGTTTTTCTGTAGGAAAAAAGG - Intergenic
1114398566 14:22388666-22388688 CAGTTTCTCTGTACGAAAAATGG - Intergenic
1114877555 14:26740104-26740126 CCATTTTTCTGGAATAATAATGG - Intergenic
1115057831 14:29152406-29152428 TGGAATTTCTGGAGGAAAAAAGG - Intergenic
1115760513 14:36576338-36576360 ATGTTTTTCTGGAAGAAGAATGG + Intergenic
1118910548 14:70058733-70058755 CCTTTTTACTGGTGGAATAAAGG + Intronic
1118996755 14:70843467-70843489 CCTTTTTATTGGAGGAAAGAAGG + Intergenic
1119363342 14:74070167-74070189 CTGTTATTTTGGAGGAAAATAGG - Intronic
1120510522 14:85408231-85408253 ATGTTATTCTAGAGGAAAAATGG + Intergenic
1121072587 14:91037988-91038010 CTATTGTTCTGGAGGAAATAGGG + Intronic
1121334947 14:93071713-93071735 CAGAGTTTGTGGAGGAAAAAAGG - Intronic
1121698262 14:95930448-95930470 CAACTTTTCTGGAGGAAAATGGG - Intergenic
1121836733 14:97098846-97098868 CATTTATTCTGCAGGAAAAAAGG - Intergenic
1125217131 15:37288000-37288022 GACTTTTTCTGGAGGCAAAAAGG - Intergenic
1125975792 15:43950323-43950345 CCCTTTTTATTGAGGAAAATAGG - Intronic
1126239120 15:46420756-46420778 CCCTTTTTCTTGAGGAAATCTGG + Intergenic
1127301163 15:57655194-57655216 CAGTTTTTCTGGTGGAAAAGGGG + Intronic
1128219683 15:65959455-65959477 CTGTTTTGATGGAGGAAAAGTGG - Intronic
1128247064 15:66140380-66140402 CCTTATTCCTGGAGGCAAAATGG + Intronic
1128487573 15:68110086-68110108 GAGATATTCTGGAGGAAAAACGG - Intronic
1129867363 15:78919468-78919490 CTTTTTATCTGGGGGAAAAAAGG - Intergenic
1130221052 15:82020070-82020092 CCCTTTTAGTGGGGGAAAAAAGG + Intergenic
1130880129 15:88047799-88047821 CCTTTGGTCTGGATGAAAAATGG + Intronic
1131026989 15:89151687-89151709 CCGTTGATCTGGGGGAAAAGTGG + Exonic
1132188051 15:99821315-99821337 CCATTTTGCTGGAGGTGAAATGG - Intergenic
1133415603 16:5604762-5604784 CCCCTTTTCTGCAAGAAAAAGGG - Intergenic
1140954302 16:79847908-79847930 CCGTTTTCCTGGTTGTAAAATGG - Intergenic
1141258434 16:82426851-82426873 TCTTTTTTCCAGAGGAAAAAAGG + Intergenic
1142311880 16:89318941-89318963 CCGGTTTTGTGGTGGAAAATTGG - Intronic
1143593076 17:7897436-7897458 CCGTTCCCCTGGAGGAAACAAGG - Intronic
1143932314 17:10442061-10442083 CTCCTTTTCTGGAGCAAAAATGG + Intergenic
1144218486 17:13078967-13078989 CTGTTTTTCAAGAGGAAGAAAGG - Intergenic
1144360058 17:14483778-14483800 CCTGTTTTCAGGAAGAAAAAGGG - Intergenic
1146136493 17:30325878-30325900 CCCTTATTGTAGAGGAAAAAAGG - Intronic
1149186927 17:54009096-54009118 GTGTTTTTCTGGGGGAAAGAAGG - Intergenic
1149197198 17:54135396-54135418 TCTTTTTTCTGGAAGAAAATAGG - Intergenic
1150642641 17:66960022-66960044 CATTATTTCTGGAGGACAAAGGG + Intergenic
1150790749 17:68198888-68198910 GCGTTTTTCTGCAGGCAACAAGG - Intergenic
1151366177 17:73617779-73617801 CTGTTTTTCTGGAGGTGAATTGG - Intronic
1151439336 17:74118210-74118232 CCATTTTTCTGGAGGACCAGTGG + Intergenic
1203172791 17_GL000205v2_random:165726-165748 CCCTGTTTCTGGAGAAGAAATGG + Intergenic
1153170019 18:2305175-2305197 CTGTCTTTCTGGAATAAAAAGGG + Intergenic
1158209420 18:55030425-55030447 GCTTTATTCTGGAGGCAAAAGGG + Intergenic
1158876396 18:61738358-61738380 CCGACTCTCTGGAGGAAAACAGG + Intergenic
1159109658 18:64042176-64042198 CCATTTTTCTGTAGGAAAGCAGG + Intergenic
1160626353 18:80210002-80210024 CCCTTCTTCTGGAAGGAAAAGGG - Intronic
1164813288 19:31175095-31175117 CCATTTGTCTGTAGGATAAAGGG + Intergenic
1165361812 19:35341453-35341475 CAGTTCTTCTGGGAGAAAAATGG + Exonic
1167716855 19:51147587-51147609 CCATTCTTAGGGAGGAAAAATGG - Intronic
1168363060 19:55759290-55759312 CTGTATTTCTGGAGGATAAGGGG + Intronic
926117405 2:10222153-10222175 CCTGTTTTATGGAGGACAAAAGG - Intergenic
926878290 2:17510434-17510456 CCGTTTTTCAGGTGAAAAAATGG - Intergenic
926988740 2:18653406-18653428 CCGTTTTTCTGCAGGATGGATGG - Intergenic
927368781 2:22330435-22330457 CAGTTTTTCTGTAGCACAAAAGG + Intergenic
927829893 2:26340682-26340704 CCGTTTTAGTGGAGTAATAAAGG + Intronic
931947325 2:67324701-67324723 CATATTTTCTGGAGGTAAAAGGG + Intergenic
933510482 2:83234788-83234810 TAGTTTTCCTGGAAGAAAAATGG + Intergenic
935142255 2:100363732-100363754 CACTTTTTCTGGAGTCAAAATGG + Intergenic
935317097 2:101845843-101845865 CCATTTTTCTGGGGGAAAAAAGG - Intronic
936368648 2:111884080-111884102 CCCCTATTCTGGAGGAAGAACGG + Exonic
936808455 2:116366266-116366288 CCTTTTTGCTGGAAGAAAATCGG + Intergenic
938681499 2:133696387-133696409 CTGTTTTTCTCAAGGAAAAAGGG + Intergenic
939379876 2:141421129-141421151 ATGTTTTTGTGGAGGAACAAGGG + Intronic
940047523 2:149425062-149425084 CAGCTTATCTGGAAGAAAAAAGG - Intronic
941571945 2:167181628-167181650 TATTTGTTCTGGAGGAAAAAAGG - Intronic
942308482 2:174632050-174632072 CCTTTAATCTGGAGAAAAAATGG - Intronic
943019000 2:182550540-182550562 CCGTTCTACTGAAGAAAAAAAGG + Intergenic
948109740 2:235445079-235445101 CATTTTGTCTGGAGGAAAGAGGG - Intergenic
948592868 2:239062657-239062679 CCTTTTAACTGGAGCAAAAAGGG + Intronic
1169218501 20:3807042-3807064 CCGTTTTTCAGATGGGAAAATGG + Intergenic
1170261528 20:14413904-14413926 CCATTATTTTGGAGGAACAAAGG - Intronic
1173501422 20:43557010-43557032 CCCATTTTCTGGAAAAAAAATGG + Intronic
1173686301 20:44925671-44925693 CCTTGTGTTTGGAGGAAAAAAGG + Intronic
1174114928 20:48220320-48220342 CCATTTTTCAAGATGAAAAATGG + Intergenic
1174985119 20:55442995-55443017 ACAATTTTCTGGAAGAAAAAGGG - Intergenic
1175536144 20:59715077-59715099 ACATTTCTCTGGAGAAAAAAAGG + Intronic
1176328784 21:5527509-5527531 CCCTGTTTCTGGAGAAGAAATGG + Intergenic
1176398973 21:6293442-6293464 CCCTGTTTCTGGAGAAGAAATGG - Intergenic
1176438184 21:6695662-6695684 CCCTGTTTCTGGAGAAGAAATGG + Intergenic
1176462446 21:7022732-7022754 CCCTGTTTCTGGAGAAGAAATGG + Intergenic
1176486007 21:7404510-7404532 CCCTGTTTCTGGAGAAGAAATGG + Intergenic
1179230719 21:39501594-39501616 CTGTCTTTCTGTAGGATAAATGG - Intronic
1180786659 22:18551408-18551430 CCTTTATTCTGGAGGATGAAAGG + Intergenic
1181131950 22:20737221-20737243 CCTTTATTCTGGAGGATGAAAGG + Intronic
1181243574 22:21490929-21490951 CCTTTATTCTGGAGGATGAAAGG + Intergenic
1182168321 22:28199820-28199842 GTGTTACTCTGGAGGAAAAATGG + Intronic
1182950683 22:34372743-34372765 CAGATTTTCTGGAGGCAACAGGG + Intergenic
949338857 3:3006797-3006819 CCCATTTTAAGGAGGAAAAACGG - Intronic
949843301 3:8343546-8343568 CTGGTGTTCTGGAAGAAAAATGG + Intergenic
950752826 3:15144366-15144388 CAGTTTGTTTGGAGGCAAAATGG + Intergenic
952271429 3:31836153-31836175 TCGTATTTCTGGATGAAAACAGG - Intronic
952387561 3:32853624-32853646 CCCTTTTTCCTGAGGAGAAATGG + Intronic
953648754 3:44779910-44779932 CCCTTCTTCTGGAAGAAAAGAGG - Intronic
955607177 3:60717838-60717860 CCATTTTTCTAGACTAAAAATGG + Intronic
956928550 3:74016427-74016449 CCATTTTACTGGAGAAAAACAGG + Intergenic
957026654 3:75190067-75190089 CAGTTTGACTGGAGGAATAAGGG + Intergenic
958558691 3:95713532-95713554 CCCTCTTCCTGGAGGGAAAATGG + Intergenic
958904084 3:99923122-99923144 GCAGTTTTCTGGAAGAAAAAGGG - Intronic
961051457 3:123750590-123750612 CTGTCTTTCTGCAGGATAAAGGG - Intronic
961285369 3:125798083-125798105 CAGTTTGTTTGGAGGCAAAATGG + Intergenic
961677100 3:128574296-128574318 CAGATTTTCTGCAGGAAAAATGG + Exonic
961684746 3:128621996-128622018 CAGTCCTTGTGGAGGAAAAAGGG - Intronic
963738738 3:149052869-149052891 CAGCTTTTCTGGAGAATAAAGGG + Intronic
965629638 3:170718882-170718904 CCATTTTCCTGGAAAAAAAAAGG - Intronic
966632386 3:182092628-182092650 CACTGTTTCTGCAGGAAAAAGGG + Intergenic
967654346 3:192028596-192028618 CCTTATTTATAGAGGAAAAAAGG + Intergenic
969741732 4:9033264-9033286 CAGTTTGTTTGGAGGCAAAATGG + Intergenic
969801098 4:9566161-9566183 CAGTTTGTTTGGAGGCAAAATGG + Intergenic
969937476 4:10696557-10696579 GAGTTTCTCTGGAGGACAAAAGG - Intergenic
970090713 4:12404520-12404542 CAGTTTTTCTGGAGGCAAGGTGG - Intergenic
970347226 4:15164211-15164233 CCCTTTTTATGGATGAGAAAAGG + Intergenic
971533668 4:27720955-27720977 CCTTCTTTGTGGAGAAAAAAAGG + Intergenic
973796351 4:54431191-54431213 CCTTTTTTCTGTATGAAAAAGGG + Intergenic
974155152 4:58062002-58062024 CTATTTTTCTGGAAGAAAATGGG - Intergenic
975788221 4:77917675-77917697 GTATTTTTCTTGAGGAAAAAAGG - Intronic
976100176 4:81553714-81553736 CCATATTTGTGGGGGAAAAATGG + Intronic
976128415 4:81857830-81857852 GCATGTTTCTGGAGGAGAAATGG - Intronic
976350195 4:84051982-84052004 CCGTTGTTCCTTAGGAAAAAAGG + Intergenic
977239153 4:94545426-94545448 ATGTTTTTCCGGGGGAAAAAAGG + Intronic
978953129 4:114585220-114585242 CAGTTGTTCTGGGGTAAAAAAGG + Intergenic
979514668 4:121594242-121594264 TCATTTTTCTTGAAGAAAAATGG - Intergenic
981569443 4:146135781-146135803 CTTTGTTTCAGGAGGAAAAATGG - Intergenic
981910022 4:149968101-149968123 CAGTTTTTCTGGAGGATCAAGGG - Intergenic
982090600 4:151876816-151876838 CAGAGTTTCTGGAGGAAAGATGG - Intergenic
983051189 4:163049363-163049385 CATTTTTTCTTTAGGAAAAAGGG - Intergenic
987417821 5:17682656-17682678 ACATTTTTATGGAGAAAAAAAGG + Intergenic
988247680 5:28708610-28708632 TCATTTTTTTGGAGGAAAAATGG - Intergenic
989686415 5:44093003-44093025 CCATTTTTGTGTTGGAAAAAGGG + Intergenic
990781830 5:59373122-59373144 ACGGTTGTTTGGAGGAAAAAAGG - Intronic
991306799 5:65185359-65185381 CCCTTGTTCAAGAGGAAAAATGG - Intronic
992130780 5:73690818-73690840 CCATTTTAATTGAGGAAAAATGG - Intronic
994164949 5:96598590-96598612 CCGTTTTTCTATGAGAAAAATGG + Intronic
996602685 5:125284283-125284305 CTATTTTTCAGGAAGAAAAATGG + Intergenic
996763342 5:127009100-127009122 CAGTTTTTGTGGAGGAAATTTGG - Intronic
1003082460 6:3032480-3032502 TCGTCTTTCTGGAAGACAAATGG - Intergenic
1003722435 6:8718678-8718700 CAGTATTTCTGGAGAAAAGAAGG - Intergenic
1003894733 6:10596553-10596575 CCGTTTTTCTGGAGGAAAAATGG + Intronic
1004169050 6:13281656-13281678 CTGTTTATCTGGAGTAAATATGG + Intronic
1004879480 6:19993126-19993148 CGGTTTTGCTGGAGCATAAAAGG + Intergenic
1005003289 6:21263933-21263955 CCATGTTTCTGGAGCAAAAAAGG - Intergenic
1005686567 6:28258930-28258952 CCTTTTTTAGGAAGGAAAAAAGG + Intergenic
1006227684 6:32554110-32554132 TATTTTTTCTGGGGGAAAAATGG + Intronic
1006663630 6:35672272-35672294 TCATTTTTCTGAAGGTAAAAGGG - Intronic
1008042544 6:46817054-46817076 CCAGTTTTCTAGGGGAAAAATGG + Intronic
1008865207 6:56202270-56202292 TTGTTTTTCTGGAGGAAAAAGGG + Intronic
1010786614 6:80009455-80009477 CCATTTTTCTAGAGAAGAAAGGG - Intronic
1011256977 6:85432417-85432439 CTAGTTTTCTGGTGGAAAAAGGG + Intergenic
1011724089 6:90190718-90190740 ACATTTTTCTGGAGGGAGAATGG - Intronic
1011773430 6:90701130-90701152 CAGTTTTTCTGGAGAAAATTGGG + Intergenic
1012246803 6:96935474-96935496 CCTTTTTTGTGAAGGAAAAGAGG + Intronic
1012321054 6:97846348-97846370 GCTTTTTTCTTTAGGAAAAAGGG + Intergenic
1012500329 6:99881213-99881235 CGGTGTATATGGAGGAAAAATGG + Intergenic
1013393627 6:109712779-109712801 CAGTTGTTTTGGAGGAAAAAAGG + Intronic
1013773162 6:113650028-113650050 TGGTTGGTCTGGAGGAAAAAGGG - Intergenic
1015314199 6:131798551-131798573 CAGTTTTTCAGGAGTAAAAATGG - Intergenic
1015559769 6:134502083-134502105 AGGTTTTTCAGGAGGAGAAATGG - Intergenic
1015869883 6:137765486-137765508 CATGTTTTCTGGGGGAAAAATGG - Intergenic
1015968858 6:138723272-138723294 CCATCATTCTGGAGGAACAAAGG - Intergenic
1017040101 6:150301160-150301182 CCGTCTTTCTGGGGACAAAAAGG + Intergenic
1021185265 7:17556688-17556710 CCAGTTTTCTGCAAGAAAAAAGG - Intergenic
1022114340 7:27249290-27249312 CCATTTTGCAGGAGGGAAAACGG + Intergenic
1024740059 7:52343692-52343714 TGGTTTTACTGGAGGAAAAGAGG - Intergenic
1030245953 7:107384517-107384539 CAGTTTTACTGGGGGAAAAGGGG - Intronic
1031140234 7:117934553-117934575 CTATTTTTCTGGAGGAAATTTGG - Intergenic
1032553083 7:132804013-132804035 GAGGTTTTCTGCAGGAAAAATGG - Intronic
1033815331 7:145064275-145064297 CCGTTCTTCTGGATTAAACATGG + Intergenic
1036246924 8:7125861-7125883 CAGTTTGTTTGGAGGCAAAATGG + Intergenic
1036253879 8:7188549-7188571 CAGTTTGTTTGGAGGCAAAATGG - Intergenic
1036363614 8:8098930-8098952 CAGTTTGTTTGGAGGCAAAATGG + Intergenic
1036450350 8:8860764-8860786 CCCTTTTTCAAGAGAAAAAAAGG - Intronic
1036688168 8:10925234-10925256 CTGTTGTTCTGGAGGAGGAAAGG + Intronic
1036887341 8:12568139-12568161 CAGTTTGTTTGGAGGCAAAATGG - Intergenic
1036894935 8:12626240-12626262 CAGTTTGTTTGGAGGCAAAATGG - Intergenic
1037135247 8:15452433-15452455 TTGTTATTCTGGAAGAAAAAAGG - Intronic
1039603656 8:38863546-38863568 CCTGCTTTCAGGAGGAAAAAGGG - Intergenic
1039656161 8:39410423-39410445 AAGTTTTTCTGCAGGGAAAAAGG - Intergenic
1040843010 8:51804510-51804532 CTGTATTTATGGAGTAAAAAGGG - Intronic
1040948979 8:52916871-52916893 ACTTTTTTCAGGAAGAAAAATGG - Intergenic
1042047505 8:64670427-64670449 CCATTTTCCTGGAGATAAAAAGG + Intronic
1042881549 8:73498151-73498173 CCTTATTTCTGGGGGGAAAAAGG + Intronic
1043047162 8:75341013-75341035 GCATTGTTCTGGAGTAAAAAGGG + Intergenic
1043529398 8:81133147-81133169 TCCTTTTTCTGGAAGGAAAAAGG - Intergenic
1046975995 8:120278367-120278389 TTGTTTTTCTGGAGAAGAAAGGG - Intronic
1047942995 8:129844593-129844615 CCATTTTACAGGTGGAAAAATGG - Intronic
1048106130 8:131411911-131411933 CAGTTTTGCTGGAGAAAGAAAGG + Intergenic
1048321149 8:133401128-133401150 CAGTTTCCCTGGAGGAAAAATGG - Intergenic
1048546685 8:135394185-135394207 CCTCATTTCTGAAGGAAAAAGGG + Intergenic
1052442952 9:28521534-28521556 ACATTTTTCAGAAGGAAAAATGG - Intronic
1052758306 9:32564899-32564921 CCGTTTTTCTAGGCCAAAAATGG - Intronic
1053942038 9:43260807-43260829 CTGTTTTTATGAAAGAAAAAAGG - Intergenic
1056600666 9:88044270-88044292 CCCCTTTCCTGGAGGAAAATGGG + Intergenic
1057522404 9:95770636-95770658 ATGTTTATCTGGAGTAAAAAGGG - Intergenic
1057800767 9:98190450-98190472 GTGTTTTTTTGGAGAAAAAAAGG + Intronic
1060688431 9:125633604-125633626 GCATTTTTCTGGAAGAGAAATGG - Intronic
1061572283 9:131485178-131485200 CCGTTTTTCTTGATAATAAATGG - Intronic
1062208918 9:135352773-135352795 ACGTTTGTCTGGAGAAGAAAAGG - Intergenic
1203433324 Un_GL000195v1:112953-112975 CCCTGTTTCTGGAGAAGAAATGG - Intergenic
1186732589 X:12426166-12426188 CCCTCTTTCTGGAAGAAATATGG + Intronic
1187734623 X:22291138-22291160 TAGGTTTTCTGGAGGAGAAATGG - Intergenic
1188459617 X:30409341-30409363 AGGTTTCTCTGGATGAAAAAGGG - Intergenic
1188823422 X:34801584-34801606 CACTTTTTCTGGAGTCAAAATGG - Intergenic
1189709317 X:43793418-43793440 GAGCCTTTCTGGAGGAAAAAGGG - Exonic
1190259208 X:48787494-48787516 GGGTTTTTCTGGAGGAGAGATGG - Intronic
1196196460 X:112842016-112842038 TCGTTTTTCTAGATGTAAAATGG - Intergenic
1196310506 X:114158648-114158670 CAATTTTTCTGGAAGTAAAATGG - Intergenic
1196512097 X:116523840-116523862 CTGTTTTTCTCAAGCAAAAAGGG + Intergenic
1196893865 X:120314138-120314160 ACTTTTTTTTGGAGGAAAAGAGG - Intergenic
1198100357 X:133416509-133416531 CCAGTTTTCTGGTGGAAAAGTGG - Intergenic
1198314016 X:135448985-135449007 TTGTTGTTTTGGAGGAAAAAAGG - Intergenic
1200550103 Y:4569000-4569022 CTTTTTTTCTGTAGAAAAAAAGG + Intergenic
1201339091 Y:12912966-12912988 ACTGTTTTCTGGAGGAAACACGG + Exonic