ID: 1003896070

View in Genome Browser
Species Human (GRCh38)
Location 6:10608945-10608967
Sequence CAGGGTGGCCAGAGAGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 508
Summary {0: 1, 1: 0, 2: 6, 3: 41, 4: 460}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003896062_1003896070 11 Left 1003896062 6:10608911-10608933 CCAGACAATGTAGGTGAATGAAA 0: 1
1: 0
2: 0
3: 11
4: 161
Right 1003896070 6:10608945-10608967 CAGGGTGGCCAGAGAGCTCCTGG 0: 1
1: 0
2: 6
3: 41
4: 460

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003896070 Original CRISPR CAGGGTGGCCAGAGAGCTCC TGG Intronic
900212262 1:1461933-1461955 CACGGTGGGCAGAGCCCTCCAGG + Intronic
900224934 1:1528584-1528606 CACGGTGGGCAGAGCCCTCCAGG + Intronic
900242599 1:1624167-1624189 CAGGGCGGCATGAGACCTCCAGG + Intronic
900265407 1:1754639-1754661 CAGGGTGGTGAAGGAGCTCCGGG - Exonic
900322572 1:2092369-2092391 CAGGGTGCCCAGAGAGGGCGGGG + Intronic
900546093 1:3230065-3230087 CAGGGATCCCAGAGAGCTGCAGG - Intronic
901529108 1:9842661-9842683 CAGGGTGGCCAGAGGCCTCTGGG - Intergenic
902174182 1:14637048-14637070 CAGGCTGCCCAGAGAGCCCAGGG + Intronic
902490582 1:16778032-16778054 GAGGGTGGCCAGAGTGTTCTGGG + Intronic
902515974 1:16989855-16989877 CAGGGCGGCCAGGGAGCTGGGGG + Intronic
902850032 1:19148026-19148048 CAGGCTGGCCAGAAGGCTCTTGG + Exonic
902875301 1:19337416-19337438 CAGGGTGACCAGACATCACCTGG - Intergenic
902891528 1:19447764-19447786 CAGTGTGGCCTGCGAGCTGCTGG - Intronic
905033396 1:34902408-34902430 CAGAGTGGACAGAGGGATCCTGG + Intronic
905132179 1:35769611-35769633 CTCCGTGGCCGGAGAGCTCCAGG - Intronic
905411959 1:37776741-37776763 GAGGCTGGCCAGTGATCTCCTGG + Intergenic
905880011 1:41457322-41457344 CAGGGGGCCCAGAGGGTTCCGGG + Intergenic
905883984 1:41481976-41481998 CAGGGTGGCCCCAGAGTTGCTGG - Intronic
906130720 1:43453730-43453752 CGGGGAGGCCGGAGAGCTCGGGG + Exonic
906666276 1:47624374-47624396 CAGGAAGGCCAGAGAACCCCAGG + Intergenic
907304387 1:53505684-53505706 CAGGGTGGGCACAGGGCTTCTGG + Intergenic
908474580 1:64474892-64474914 CAGGTTGGTCAGACAGCTGCTGG + Intronic
913467740 1:119159523-119159545 CAGGGTGCTGAGGGAGCTCCAGG - Intergenic
913546406 1:119872956-119872978 CAGGGTTGTCAGAGTGTTCCAGG + Intergenic
914897306 1:151688202-151688224 CAGGGTGGTCAGAGAGACTCAGG + Intronic
915317459 1:155037187-155037209 CAGAGTGGAGGGAGAGCTCCTGG - Intronic
916108676 1:161448016-161448038 CACGGCGCCCAGAGAGCTGCCGG - Intergenic
916110264 1:161455397-161455419 CACGGCGCCCAGAGAGCTGCCGG - Intergenic
916111849 1:161462807-161462829 CACGGCGCCCAGAGAGCTGCCGG - Intergenic
916113436 1:161470188-161470210 CACGGCGCCCAGAGAGCTGCCGG - Intergenic
919779607 1:201213479-201213501 CAAGGTGACCAGGGGGCTCCCGG - Exonic
920007678 1:202845248-202845270 CAGGCTGCCCAGAGTGCCCCAGG + Intergenic
920055906 1:203191500-203191522 CAGGGTGGTCAGACATCCCCTGG - Intergenic
920929749 1:210376313-210376335 CAGACTGGCTAGAGAGCTCAGGG - Intronic
922919839 1:229293212-229293234 GATGGGGGTCAGAGAGCTCCTGG - Intronic
924283012 1:242457047-242457069 CAGGGAGCCCAGAGACCCCCTGG - Intronic
924633439 1:245763373-245763395 CAGGGTGGGCAGAGAGCTGTAGG + Intronic
924784861 1:247185242-247185264 CAGGCTCCCCAGAGAGCCCCTGG - Intergenic
1063409726 10:5828103-5828125 GAGGGTTGCAGGAGAGCTCCTGG - Intronic
1063572993 10:7233806-7233828 AAGGGTTGCCACAGAGCCCCTGG - Intronic
1064035064 10:11908223-11908245 TGGGGAGGCCAGAGGGCTCCCGG - Intergenic
1064162854 10:12960680-12960702 GAAGATGGCCAGAGAGCTCAAGG + Intronic
1065895374 10:30158669-30158691 CAAGGTGGCCAGAGAGATGAAGG - Intergenic
1065916364 10:30357510-30357532 CAGAGAGGGCAGAGAGCTCGTGG + Intronic
1067424403 10:46194116-46194138 CAGGCTGCCCAAAGAGCACCAGG - Intergenic
1067453277 10:46395545-46395567 CAGGGTGACCAGACATCACCTGG - Intergenic
1067583958 10:47464221-47464243 CAGGGTGACCAGACATCACCTGG + Intronic
1067726644 10:48775603-48775625 CTGGGAGGTCAGGGAGCTCCAGG + Intronic
1069802418 10:71090391-71090413 TGGGGTGGCAAGAGAGCCCCAGG + Intergenic
1070780625 10:79135642-79135664 CTGGGTGGCCAGAGAGCTAAGGG + Intronic
1072044140 10:91637819-91637841 CAGGATGGCCAAAGAGGACCAGG + Intergenic
1072232627 10:93425952-93425974 CTGGGTGGGCAGGGAGCTACAGG + Intronic
1074892095 10:117744208-117744230 CAGAGTGGTCAGAGAGGGCCAGG + Intergenic
1075071955 10:119325619-119325641 CCATGTGGCCAGAGGGCTCCTGG - Intronic
1076538230 10:131196632-131196654 CAAGGTGGCCTCCGAGCTCCAGG - Intronic
1076550140 10:131272932-131272954 CAGGGAAGCTACAGAGCTCCCGG - Intronic
1076948392 10:133666316-133666338 CCGGGTGCCCGCAGAGCTCCGGG - Intergenic
1076949381 10:133669626-133669648 CCGGGTGCCCGCAGAGCTCCGGG - Intronic
1076950365 10:133672925-133672947 CCGGGTGCCCGCAGAGCTCCGGG - Intergenic
1076951350 10:133676224-133676246 CCGGGTGCCCGCAGAGCTCCGGG - Intergenic
1076952340 10:133679534-133679556 CCGGGTGCCCGCAGAGCTCCGGG - Intergenic
1076953328 10:133682844-133682866 CCGGGTGCCCGCAGAGCTCCGGG - Intergenic
1076955296 10:133742495-133742517 CCGGGTGCCCGCAGAGCTCCGGG - Intergenic
1076956286 10:133745805-133745827 CCGGGTGCCCGCAGAGCTCCGGG - Intergenic
1076957274 10:133749114-133749136 CCGGGTGCCCGCAGAGCTCCGGG - Intergenic
1076958263 10:133752424-133752446 CCGGGTGCCCGCAGAGCTCCGGG - Intergenic
1076959247 10:133755723-133755745 CCGGGTGCCCGCAGAGCTCCGGG - Intergenic
1076960236 10:133759033-133759055 CCGGGTGCCCGCAGAGCTCCGGG - Intergenic
1077233290 11:1468268-1468290 TAGGGTGTGCAGGGAGCTCCTGG - Intergenic
1077340645 11:2024889-2024911 CAGGTTGGGCAGAGACCCCCAGG + Intergenic
1077530498 11:3092641-3092663 AACAGTGGCCAGAGACCTCCAGG + Intronic
1077608933 11:3631984-3632006 CCAGGAGGCCAGAGAGCTCTAGG + Intergenic
1079217751 11:18528880-18528902 CAGGCTGGCCTCAGAACTCCTGG + Intergenic
1081872038 11:46387641-46387663 GAAGGAGGCCAAAGAGCTCCAGG + Intergenic
1083018280 11:59479058-59479080 TAGGGTGGCCAGTGAGCTTGGGG - Intergenic
1083683440 11:64361765-64361787 GAGGGCGGCCAGAGGGCTGCAGG + Intronic
1084387941 11:68855666-68855688 CAGGGTGGACCGAGAACACCCGG - Intergenic
1084399231 11:68934082-68934104 CAGGGTGAGCAGACCGCTCCTGG + Intronic
1084462114 11:69301970-69301992 CAGTGAGGTCAGAGGGCTCCCGG - Intronic
1084529164 11:69717023-69717045 GAGGGTGGCCAGAGGGAGCCAGG + Intergenic
1088506189 11:110529899-110529921 CAGGGTGGCCAGGCAAGTCCTGG + Intergenic
1088887526 11:114019574-114019596 CAGTGAGGACAGAGAGCTCTTGG - Intergenic
1088977679 11:114830313-114830335 CAGGGTGTCAAGAGAGCTGTGGG + Intergenic
1089021465 11:115219698-115219720 CTGGGTGGCTCAAGAGCTCCTGG + Intronic
1089980964 11:122772219-122772241 CAGGGTGTCAAGAGAGCTCACGG - Intronic
1090286779 11:125506462-125506484 CAGGGTGGTCAGACATCACCTGG - Intergenic
1090400877 11:126447484-126447506 GAGGGTGGCCTGAGAGCACCGGG - Intronic
1202823630 11_KI270721v1_random:80078-80100 CAGGTTGGGCAGAGACCCCCAGG + Intergenic
1091567837 12:1661712-1661734 CAGGGAGGGCACATAGCTCCGGG - Intergenic
1092659404 12:10722711-10722733 CAGGGTCCCCAGGGATCTCCGGG - Intronic
1093706124 12:22276537-22276559 CAAGGTGGCCAGATGGTTCCAGG + Intronic
1094122189 12:26986302-26986324 CAGGGTGGTCAGACATCACCTGG - Intronic
1094352898 12:29546292-29546314 GAGGGTGGCCAGAAAGCTGAGGG + Intronic
1095443244 12:42259284-42259306 CAGGGTGACCAGATATCACCTGG + Intronic
1096611904 12:52807597-52807619 CATGAGGGCCAGAGAGGTCCAGG - Intronic
1097661568 12:62436157-62436179 CAGGAGGGCCTGAGAGCTGCAGG + Intergenic
1098169107 12:67728302-67728324 CAGGGTGGGCTGACAGCTCTGGG + Intergenic
1100976479 12:100127801-100127823 CAGGCTGGTCTCAGAGCTCCTGG - Intronic
1102035619 12:109769060-109769082 CAGGGGGCCCAGCCAGCTCCCGG - Exonic
1102637500 12:114336909-114336931 CAGGGTGGTCAGACATCACCTGG - Intergenic
1102997196 12:117360234-117360256 CACTGTGACCAGAGAGCTCATGG - Intronic
1103165002 12:118762905-118762927 TAGGCTGGGCAGTGAGCTCCAGG + Intergenic
1103176004 12:118863734-118863756 CAGGGCGCCCAGAGAGGACCAGG + Intergenic
1103737758 12:123071158-123071180 TAGGGTGGGCAGAGGGCTGCAGG + Intronic
1104871526 12:132001707-132001729 CAGGGCCACCAGAGGGCTCCTGG - Intronic
1104878289 12:132051939-132051961 CAGGGCCACCAGAGGGCTCCTGG - Intronic
1104951799 12:132444470-132444492 CAGGGGAGACAGAGGGCTCCGGG - Intergenic
1104967386 12:132514361-132514383 CAGGGAGGCCAGAGAGATCCTGG - Intronic
1105020132 12:132810640-132810662 CAGGGCCACCAGAGGGCTCCTGG + Intronic
1105043055 12:132977062-132977084 CAGGGCCACCAGAGGGCTCCTGG + Intergenic
1106485815 13:30171624-30171646 CAAGGTGGCCAAGGAGCTCCAGG + Intergenic
1107870737 13:44744382-44744404 CAGGGTGTCCAGCTAGCTCTAGG + Intergenic
1108128710 13:47273878-47273900 CAAGCTGGTAAGAGAGCTCCAGG + Intergenic
1110575164 13:77047531-77047553 AAGGGTCCCCAGAGAGCCCCAGG + Intronic
1112319655 13:98395082-98395104 CTGCTAGGCCAGAGAGCTCCGGG + Intronic
1113313856 13:109158126-109158148 CAGAGTGGCCACTGCGCTCCAGG + Intronic
1113562559 13:111293891-111293913 CAGAGCTGCCAGGGAGCTCCTGG + Exonic
1113604645 13:111596592-111596614 CAGGAGGGCCAGGGAGGTCCTGG - Intronic
1117090757 14:52247736-52247758 CAGTGTGGCCAGAGAAGTCAGGG + Intergenic
1117327816 14:54684960-54684982 GAGGGTGGCCAGGAAGCTGCAGG + Intronic
1118610013 14:67532917-67532939 AGGGGTGGCCAGAGCGCCCCGGG - Intronic
1118615579 14:67572470-67572492 GAGGGAGCCCAGAGAGCTCCTGG + Intronic
1118716833 14:68565877-68565899 GAGAGTGGCCAGACACCTCCAGG - Intronic
1118899270 14:69973009-69973031 CAGCGTGGCCATTCAGCTCCTGG + Intronic
1119516316 14:75251433-75251455 CAGAGTGGCCAGTGAGAGCCTGG + Intronic
1120645468 14:87069244-87069266 CTGGGTGGTCAGAGGGCCCCGGG - Intergenic
1121088846 14:91167450-91167472 GAGGCTGGACAGAGAGGTCCCGG - Intronic
1121263281 14:92581969-92581991 CAGGGTGATCAGACAGCACCCGG + Intronic
1121521723 14:94590522-94590544 CAGAGTGGGCAGAGACCTCTGGG + Intronic
1121610311 14:95274207-95274229 CTGGGTGCGCAGAGAGCTCACGG - Intronic
1121814755 14:96920683-96920705 GAGGGTGGCCTGGGAGCTGCTGG - Intronic
1121998957 14:98630237-98630259 CAGGGTGGGGAGAGGGCTCTTGG + Intergenic
1122954364 14:105063315-105063337 CTTGCAGGCCAGAGAGCTCCAGG - Intronic
1202859839 14_GL000225v1_random:73976-73998 CCGGGTGCCCGCAGAGCTCCGGG + Intergenic
1202862523 14_GL000225v1_random:91274-91296 CCGGGTGACCGCAGAGCTCCGGG + Intergenic
1202863621 14_GL000225v1_random:100925-100947 CCGGGTGCCCGCAGAGCTCCGGG + Intergenic
1123760115 15:23425334-23425356 CAGGGTGGCCGGAAACCTGCTGG + Intergenic
1124197841 15:27648426-27648448 TAGGGAGGGCAGAGAGCTACAGG - Intergenic
1124214712 15:27796895-27796917 GAGGGTTGCCAGAGAGCTCCAGG - Intronic
1124283841 15:28385198-28385220 GAGAGTGGCAGGAGAGCTCCAGG + Exonic
1124298856 15:28526416-28526438 GAGAGTGGCAGGAGAGCTCCAGG - Exonic
1124320079 15:28705644-28705666 GAGAGTGGCAGGAGAGCTCCAGG - Exonic
1124359667 15:29026588-29026610 CAGGGTGGTCTAACAGCTCCAGG - Intronic
1124482433 15:30089773-30089795 GAGAGTGGCAGGAGAGCTCCAGG + Exonic
1124488892 15:30141875-30141897 GAGAGTGGCAGGAGAGCTCCAGG + Exonic
1124543976 15:30610839-30610861 GAGAGTGGCAGGAGAGCTCCAGG + Exonic
1124563939 15:30798277-30798299 TAGAGTGGCAGGAGAGCTCCAGG + Intergenic
1124754638 15:32396448-32396470 GAGAGTGGCAGGAGAGCTCCAGG - Exonic
1124959321 15:34382958-34382980 GAGAGTGGCAGGAGAGCTCCAGG - Exonic
1124975947 15:34529179-34529201 GAGAGTGGCAGGAGAGCTCCAGG - Exonic
1126849919 15:52790517-52790539 CTGGATGGCCAGGGAGCTGCGGG + Intronic
1128664585 15:69528874-69528896 CAGGGTGGCAAGAGAACGCAGGG - Intergenic
1129372477 15:75106202-75106224 GTGGGTGGCCAGAGGGCTCGTGG + Intronic
1129476824 15:75791380-75791402 CAGAGAGGGCAGAGAGCTCGTGG - Intergenic
1129696510 15:77743310-77743332 CAGAGGGGACAGAGAGCCCCAGG + Intronic
1130667259 15:85880184-85880206 CAGGGTGGAAAGAGAGATCACGG - Intergenic
1130958957 15:88647164-88647186 CATGGTGGCCAGGAGGCTCCGGG + Intronic
1130964452 15:88686510-88686532 CTGGGAGGCCAGGCAGCTCCAGG - Intergenic
1131057293 15:89383258-89383280 CTGTGTGGCCAGAGGCCTCCTGG - Intergenic
1131232095 15:90666802-90666824 GAGGGTGGCCAGGCAGCTCCTGG + Intergenic
1133090058 16:3397199-3397221 GAGGATGTACAGAGAGCTCCTGG - Exonic
1133125462 16:3643132-3643154 CAGAGGAGCCAGAGAGCTGCAGG + Intronic
1133213478 16:4276009-4276031 CAGTGTGGGCAGCCAGCTCCCGG - Intergenic
1133655373 16:7857340-7857362 CAGAGTAGCCCGAGAGCTCCTGG + Intergenic
1134090514 16:11389147-11389169 CAGCGTGGTAAGAGCGCTCCAGG - Intronic
1134456224 16:14397542-14397564 CAGGGTGGCCAGAAACCTGCTGG - Intergenic
1135221768 16:20620774-20620796 CAGGGTGCCCTGAGAGGACCAGG - Intronic
1136178944 16:28537974-28537996 CGGGGGGCCCAGAGAGCTCAAGG - Intronic
1136347906 16:29688271-29688293 CAAGGTGGTCAGACAGCGCCTGG + Intronic
1137557668 16:49482957-49482979 CAGGGTGGCCAGGGGGCACCTGG + Intergenic
1138832754 16:60395031-60395053 CAGGGTGGGCAGAGAGATGGTGG - Intergenic
1139236333 16:65343426-65343448 CCAGGTGGCCAGAGACCACCTGG + Intergenic
1139464227 16:67145581-67145603 CAGGGTGGCCCAGGAGCTCCTGG - Exonic
1139548872 16:67662553-67662575 CAGGGAGGGCAGAGAGCTGCGGG - Exonic
1139696466 16:68678755-68678777 CAGCGTGGCCAAAGAGCTGTGGG - Exonic
1139853445 16:69963768-69963790 CAGGGAGGCCAGTGAGGGCCAGG + Exonic
1139882416 16:70186677-70186699 CAGGGAGGCCAGTGAGGGCCAGG + Exonic
1140031568 16:71343477-71343499 CTGGGTGGACTGAGAACTCCTGG - Intergenic
1140288008 16:73622749-73622771 CAGGGTGCCCTTAGAGCTGCTGG - Intergenic
1140370094 16:74408827-74408849 CAGGGAGGCCAGTGAGGGCCAGG - Exonic
1140740534 16:77937300-77937322 GCGGGTGGCCAGAGACCTTCAGG + Intronic
1141624408 16:85253716-85253738 GAGGGTGGCAAGAGTGCTCCCGG + Intergenic
1141663244 16:85452951-85452973 CAGAGAAGCCAGAAAGCTCCAGG - Intergenic
1141674421 16:85510114-85510136 CAGGGAGCCCTGAGGGCTCCAGG - Intergenic
1142107778 16:88315582-88315604 CAGGGAGGCCTGAGAGCTCCTGG - Intergenic
1142251125 16:88992563-88992585 CAAGGTGGCCCGAGAGATACTGG + Intergenic
1142359286 16:89619110-89619132 CAGGGGGGGCAGGGAGCTGCAGG - Intronic
1143118309 17:4592843-4592865 CAGGGAGGCTAGAGCCCTCCTGG + Intronic
1143166518 17:4899773-4899795 CAGGGTGTCCAGGGAGCTGGGGG - Exonic
1143723256 17:8828465-8828487 CAGGGTGGCAAGAGAGGGTCAGG - Intronic
1143877145 17:10000512-10000534 CAGGTTGGTCAGAGAGATCTAGG + Intronic
1144431544 17:15196774-15196796 GAGGTTGGACAGAGAGCTGCTGG - Intergenic
1144640583 17:16934409-16934431 CAGGGAGGCCACAGAGGTCAGGG + Intronic
1146458886 17:33028206-33028228 CAGGGTGGCCACAGGGCCCTGGG - Intronic
1147235660 17:39055620-39055642 AAGGGTCCCCAGAGAGCTCCCGG - Intergenic
1147563745 17:41524232-41524254 CCGTGTGGCCAGCGACCTCCCGG + Exonic
1147585561 17:41652466-41652488 CAAGGTCCCCAGAGAGCCCCTGG + Intergenic
1147951645 17:44111033-44111055 CAGGGAGGCCCTAGAGCTGCAGG + Intronic
1148497403 17:48061159-48061181 CAAGGTGGCCAGATGGTTCCAGG + Exonic
1149243479 17:54678333-54678355 CAGGCTGGCCAGGGAGGTCTGGG + Intergenic
1149680493 17:58503751-58503773 GAGAGCGGCCAGAGAACTCCTGG + Exonic
1150594835 17:66594787-66594809 CAGGTTGGCCACAGAACTGCAGG + Intronic
1151135532 17:71942881-71942903 CAGGCATGACAGAGAGCTCCTGG - Intergenic
1151419968 17:73990812-73990834 CATGGAGGGCAGAGAGCCCCTGG + Intergenic
1151483310 17:74383206-74383228 CAGGGAGGCCAGGGAGCAGCTGG + Intergenic
1151630756 17:75309330-75309352 CAGGGACGCCACAGGGCTCCAGG - Intergenic
1152236373 17:79141142-79141164 AACGGAGGCCTGAGAGCTCCTGG + Intronic
1152330500 17:79669936-79669958 CACAGTGGCCAGTGGGCTCCTGG + Intergenic
1152564952 17:81096249-81096271 CATGGTGGGCAGAGAGCTCAGGG - Intronic
1152794183 17:82298776-82298798 CAGGGGGCCCAGGGAGCTCCGGG + Intergenic
1153134942 18:1905908-1905930 CAGGGTGACCAGACATCCCCTGG + Intergenic
1153490158 18:5639171-5639193 CAAGGGGGCCAGAGAGTGCCAGG - Intergenic
1155078410 18:22383422-22383444 CAGGATGGCTACAAAGCTCCAGG - Intergenic
1155295548 18:24381307-24381329 CAGGGTGGTCAGACACCACCTGG + Intronic
1155499394 18:26471882-26471904 CAAGGAGTCCAGAGAGCTGCTGG + Intronic
1157221349 18:45830292-45830314 CAGGGTAGGCAGAGAGCTCCAGG - Intronic
1157849032 18:51030428-51030450 CAGGGCGGCCCGGGAGCTCGAGG + Exonic
1158713084 18:59854463-59854485 CAGGTGGTCCAGGGAGCTCCTGG - Intergenic
1159926670 18:74275899-74275921 TAGGGTGGCCAGGGAGGACCCGG + Intronic
1160144449 18:76352151-76352173 CAGGATGTCCAGAGAGCTGGGGG + Intergenic
1160744008 19:702055-702077 AACTGAGGCCAGAGAGCTCCGGG - Intergenic
1161237521 19:3205241-3205263 TGGGGTGGCCAGACAGTTCCAGG - Intronic
1161345731 19:3767993-3768015 CAGGGTAGCCCGAGGGCTCCTGG + Intronic
1161682070 19:5685080-5685102 CAGTGTGGGCAGTGAGCACCAGG - Exonic
1161705527 19:5819087-5819109 GAGGGGGTCCAGAGAGGTCCGGG + Intergenic
1162320546 19:9968710-9968732 CTGGGAGGCCAGAGGGCCCCTGG + Exonic
1162321607 19:9973953-9973975 CAGGGTCCCCATGGAGCTCCAGG - Exonic
1162609705 19:11739341-11739363 CAGGGTGGCCTGTGTGCCCCGGG - Intergenic
1162667898 19:12230579-12230601 AGTGGTGGCCAGAGACCTCCAGG + Intronic
1163290552 19:16376737-16376759 CAGAGTGGCCACAGGGCTGCCGG + Intronic
1163633282 19:18427618-18427640 CAGGGTGGGCAGAGGGCCCCAGG - Intronic
1163633303 19:18427670-18427692 CAGGGTGCCCAGAGAACATCTGG - Intronic
1163819277 19:19486998-19487020 AAGGGTGGCCAGTGAGCTCCAGG + Intronic
1164158726 19:22612481-22612503 CAGGCTGGTCAGAGGGCTGCAGG - Intergenic
1164520642 19:28976674-28976696 CAGGGTTGCATGAGGGCTCCAGG + Intergenic
1164670103 19:30067574-30067596 CAGGCTGGGCAGAGGGATCCTGG + Intergenic
1164842152 19:31400622-31400644 CAGGCTTGCAAGAGAGCTCTTGG + Intergenic
1165401494 19:35603565-35603587 CAGGGTGACCAGACATCACCAGG + Intergenic
1165406166 19:35632672-35632694 CAGGGTTCTCAGGGAGCTCCTGG - Intronic
1166041365 19:40204830-40204852 CAGGTTGTCCTGAGAGCTCTGGG - Intronic
1166079440 19:40434373-40434395 CAGGGCAGGCAGAGAGCTGCAGG + Intergenic
1166806209 19:45488821-45488843 CAGGAGGGGCTGAGAGCTCCAGG + Intronic
1166863433 19:45822590-45822612 GAGGGTGGCCTGGGAGCTCCGGG + Intronic
1167050348 19:47074253-47074275 CAGTGTTGGCAGAGAACTCCTGG - Intronic
1167153415 19:47723131-47723153 CAGGGTGGGCAGGGGGATCCAGG - Intronic
1167868045 19:52344229-52344251 CTGAGGGGCCAGAGAGTTCCAGG - Intronic
1168246531 19:55115498-55115520 CAGGGTGGCCACTGAGAACCGGG + Intronic
1168288160 19:55344677-55344699 CAGGGAGGCCAGAGAGCCCCAGG + Intronic
1168720174 19:58550517-58550539 CAGGGCCACCAGACAGCTCCTGG - Exonic
925106264 2:1295156-1295178 CAGAGTTGCCACAGAGCTCATGG - Intronic
925339617 2:3127085-3127107 CAGGGAAGCCTGAGAGCTGCTGG + Intergenic
926776749 2:16430770-16430792 CAGGGAGGTCAGTGAGATCCTGG - Intergenic
927443538 2:23137848-23137870 CAGGGGGGACAGAGAGCATCAGG - Intergenic
931824906 2:65990396-65990418 CAGGGTGACCAGACATCACCTGG - Intergenic
934525394 2:95048575-95048597 CAGGGCTGCCAGAGAGCACTGGG + Intronic
934753484 2:96809526-96809548 CAGGGTGGGCAGGGGGCCCCGGG - Exonic
935330204 2:101971804-101971826 CAGGGTAGCCAGATGGCTACAGG + Intergenic
935916657 2:107959827-107959849 CACGGTGGCCAGATAGCTAGTGG + Intergenic
936912055 2:117603525-117603547 CAGGGTGGCCTGAGGTCCCCAGG - Intergenic
937453994 2:122025732-122025754 CAGGGTGACCAGACATCACCTGG + Intergenic
940405835 2:153300969-153300991 CAAGGTGGACAGATAGCTTCAGG + Intergenic
941893322 2:170605088-170605110 CAGGGTTGCCAAAGACCTCCAGG + Intronic
941998384 2:171622996-171623018 CAGGGTGGCCAGCCAGCACTTGG + Intergenic
943800006 2:192045758-192045780 CATGGTGGCCAGCCAGCTCCTGG + Intronic
946015982 2:216604345-216604367 CAGGGTGATCAGACAGCACCTGG + Intergenic
946032471 2:216716129-216716151 CAGGGCAACCAGAGTGCTCCGGG - Intergenic
947163961 2:227242410-227242432 CATGGTGTTCAGAGAGCTTCTGG - Intronic
947575362 2:231269609-231269631 CAAGGTGGGCAGAGAGGTCAGGG - Intronic
947748341 2:232520703-232520725 CAGGCTGGCCCGAGAGCCGCGGG + Intronic
947949256 2:234133752-234133774 CAGGGTGATCAGACAGCACCCGG + Intergenic
948341967 2:237260698-237260720 CTGGGTGCCCAGAGACCTCGAGG + Intergenic
948404549 2:237707237-237707259 CGAGGTGGCCAGCAAGCTCCTGG - Intronic
948629685 2:239294105-239294127 CAGGTTGGGCAGAAAGCTCATGG + Intronic
948657632 2:239486537-239486559 CATGGCTGCCAGGGAGCTCCAGG + Intergenic
948890975 2:240906966-240906988 CAGGGTGGAGAGAGAGCCCGGGG + Intergenic
948901069 2:240957170-240957192 CAGGGAGGGCAGAGAGCTGGGGG - Intronic
949035497 2:241814152-241814174 GAGGCTGGCCAGAGAGCCCCCGG - Intronic
1169011011 20:2250385-2250407 CAGGATGGCCAGAGAACTTAAGG - Intergenic
1170462999 20:16596753-16596775 CAGGGCCACCAGACAGCTCCTGG - Intergenic
1170747889 20:19116865-19116887 CAGAGAGGCCAGTGACCTCCAGG + Intergenic
1171010377 20:21506119-21506141 CCCAGTGGCCAGAGCGCTCCTGG + Intergenic
1172979722 20:38931767-38931789 CTGTGTGGTCAGAGAGCTGCTGG - Intronic
1173125612 20:40333360-40333382 CAGGGAGGCCAGAGAGGGACTGG - Intergenic
1173184637 20:40831186-40831208 CTGGGTAGTCAGTGAGCTCCCGG - Intergenic
1173290593 20:41711320-41711342 CAGGGTGGCCATATAGTTCTGGG + Intergenic
1173591593 20:44229069-44229091 CAGAGTGGGCAGACAGCTCCTGG + Intergenic
1174105097 20:48156290-48156312 TAGGGGGTGCAGAGAGCTCCAGG + Intergenic
1175570242 20:60012615-60012637 CAAGCTGGCCAGAGAGCTGAGGG - Exonic
1175930021 20:62489503-62489525 CAGCGTGGCCAGTGGGCTCCGGG + Intergenic
1175944944 20:62554379-62554401 CAGTGCGGCGAGAGAGGTCCCGG - Intronic
1175974216 20:62702285-62702307 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1175974240 20:62702355-62702377 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1176869163 21:14072778-14072800 CAAAGTGGCAAGAAAGCTCCGGG - Intergenic
1177716653 21:24847215-24847237 AAGGGTCCCCAGAGAGCCCCTGG - Intergenic
1178433547 21:32537248-32537270 AAGGGTGGAAAGAGAGCTCCAGG + Intergenic
1179133089 21:38656144-38656166 CAGGGAGGGCAGAGAGGTTCAGG + Intronic
1179358717 21:40685492-40685514 CAGGGGAGCAGGAGAGCTCCTGG - Intronic
1179628471 21:42661986-42662008 CAGGGAGGCCACACAGCTGCTGG - Intronic
1180720761 22:17906695-17906717 CCAGGTGGTCACAGAGCTCCTGG + Exonic
1180800415 22:18629239-18629261 CAGGATGGCCAGACCGCACCTGG + Intergenic
1180851649 22:19024795-19024817 CAGGATGGCCAGACCGCACCTGG + Intergenic
1181221304 22:21366023-21366045 CAGGATGGCCAGACCGCACCTGG - Intergenic
1181458122 22:23070850-23070872 GAGGGTGGACAGAGGGCGCCGGG + Intronic
1182451136 22:30422604-30422626 CACGATGGCCAGCCAGCTCCTGG - Exonic
1182866190 22:33606588-33606610 CAGGGTGGAGAGAGAGCACGGGG - Intronic
1183102118 22:35590693-35590715 CAGAGTGGCCAGACAGCTTCAGG + Intergenic
1183275273 22:36892534-36892556 CAGCCTGGGAAGAGAGCTCCAGG - Intergenic
1183906958 22:41048959-41048981 CCTGGTGGCCTGAGAGCTGCGGG + Intergenic
1184207003 22:43011419-43011441 GAAGGTGGCCAGAGAGCATCTGG + Intronic
1184526940 22:45029620-45029642 CAGTGTGTCCAGAGAGCAGCAGG + Intergenic
1184661045 22:45965646-45965668 CAGGCTGGTCTCAGAGCTCCTGG + Intronic
1184669324 22:46004511-46004533 CAGGGTGGCCAGAGACCCTTTGG - Intergenic
1184762344 22:46551646-46551668 CCGTGTGGCCAGAGAGCTGGAGG - Intergenic
1184795782 22:46731646-46731668 CAGGGAGGGCAGAGGGCACCTGG + Intronic
1184908547 22:47509444-47509466 CAGGGTGACCAGACATCACCCGG + Intergenic
1185147534 22:49147366-49147388 CACGGTGGCCGCAGAGCCCCGGG - Intergenic
949971991 3:9415771-9415793 CAGGGTGGCCTCAAAACTCCTGG + Intronic
951869620 3:27346623-27346645 CAAGCTGACTAGAGAGCTCCTGG + Intronic
952822566 3:37498035-37498057 CTGGGTGGCCAGGGAGCTGTGGG + Intronic
953253749 3:41268973-41268995 CAGCGTGGCCAGTGAGCGCTTGG - Intronic
953901306 3:46845686-46845708 CAGGGTGTCCCGGGAGCTGCGGG + Intergenic
954581863 3:51707286-51707308 CAGCGTTCCCTGAGAGCTCCGGG + Intronic
955233029 3:57115647-57115669 AAGAGTGGCCAGACAGCTCATGG - Intronic
955326720 3:58014359-58014381 CAAGCTGGACAGGGAGCTCCAGG + Intronic
955751020 3:62185520-62185542 CTTGGGGGCCAGAGAGCTGCCGG + Intronic
956738293 3:72255733-72255755 CAGGATGGGCTGTGAGCTCCAGG + Intergenic
957217053 3:77334205-77334227 CAGGGTGGCCAGAGATTTTGAGG + Intronic
957633900 3:82757122-82757144 CAGGGTGGTCACAGTTCTCCAGG + Intergenic
960634263 3:119768204-119768226 CAGGGGAGGCAGACAGCTCCTGG - Intergenic
961511675 3:127407387-127407409 CAGGGTTGGCAGTGAGCACCAGG + Intergenic
961522081 3:127472761-127472783 CGGGGTGGGCAGAGACCTTCGGG - Intergenic
961664255 3:128486392-128486414 CAGGGTGGGCAGAAAGATCAGGG + Intronic
961667939 3:128505202-128505224 CATGGTGGCGAAAGAGCTGCCGG + Intergenic
962261912 3:133915856-133915878 CAGGGTGCCTGGATAGCTCCGGG - Intergenic
963127186 3:141827151-141827173 CAGGGTGGGAAGAGAGCTGGTGG + Intergenic
963949392 3:151182484-151182506 AAGGGTGGCCAGGGAGCCTCTGG + Intronic
965610510 3:170538738-170538760 CAGGCCAGCCTGAGAGCTCCTGG - Intronic
966238455 3:177728521-177728543 CAGGGTGGTCAGACATCACCTGG + Intergenic
967982584 3:195074626-195074648 CAGGGTGTCCGGAGAGCCTCTGG - Intronic
968073374 3:195801997-195802019 CAGGGTGGCCAGAGAGGGAGGGG - Intronic
968654479 4:1772655-1772677 CAAGGTGGCCAGAGAGGACGTGG - Intergenic
968830308 4:2930237-2930259 CAGGGTGTCCAGGGAACTGCTGG + Intergenic
969285721 4:6200698-6200720 CACGGCGGCAGGAGAGCTCCCGG - Intergenic
969341887 4:6547419-6547441 CAGGGTGACCAGTGAGGTCGAGG - Intronic
969571388 4:8010750-8010772 CAGAGGGGGCAGGGAGCTCCGGG + Intronic
969592542 4:8130225-8130247 CAGGGTGGCCAGGGTGGTGCTGG + Intronic
969703444 4:8780098-8780120 CATAGTCGGCAGAGAGCTCCAGG - Intergenic
969706939 4:8817170-8817192 CAAGGTCGCTGGAGAGCTCCAGG + Intergenic
974405433 4:61462218-61462240 CAGGGGAGCCAGAAAGCTTCTGG + Intronic
976609898 4:87019592-87019614 CTGGGTCTCCAGAGAGCTTCTGG + Intronic
977465410 4:97378298-97378320 CATGTTGTCCAGAGAGCTACTGG - Intronic
978033733 4:103969673-103969695 CAGGGTGCCCATAGAACTGCTGG + Intergenic
979399310 4:120228621-120228643 CAGGATGGTCAGATAGGTCCTGG - Intergenic
979876635 4:125899565-125899587 CAGGGTGGCCAGAGAGATAATGG - Intergenic
981752868 4:148109304-148109326 CAGGGCAGCCAGACAGCACCTGG - Intronic
984651935 4:182279803-182279825 CAGGGACACCACAGAGCTCCTGG - Intronic
984889064 4:184474976-184474998 CAGGGTGGCCTGAAGGTTCCAGG + Intergenic
984893222 4:184512104-184512126 CAGAGTGGCCAAACAGCTGCAGG - Intergenic
985451846 4:190067120-190067142 CCGGGTGCCCGCAGAGCTCCGGG - Intergenic
985452836 4:190070412-190070434 CCGGGTGCCCGCAGAGCTCCGGG - Intergenic
985453823 4:190073705-190073727 CCGGGTGCCCGCAGAGCTCCGGG - Intergenic
985454811 4:190076998-190077020 CCGGGTGCCCGCAGAGCTCCGGG - Intergenic
985455799 4:190080295-190080317 CCGGGTGCCCGCAGAGCTCCGGG - Intergenic
985456782 4:190083589-190083611 CCGGGTGCCCGCAGAGCTCCGGG - Intergenic
985457770 4:190086885-190086907 CCGGGTGCCCGCAGAGCTCCGGG - Intergenic
985458758 4:190090182-190090204 CCGGGTGCCCGCAGAGCTCCGGG - Intergenic
986748346 5:10762842-10762864 CAGGGTGGCCAGAGAACTGGAGG - Intergenic
988037717 5:25850118-25850140 CAGGATGGACAGGGAGTTCCTGG - Intergenic
988218882 5:28315642-28315664 TATGGAGGCCAGAGAGCCCCTGG - Intergenic
988602575 5:32653688-32653710 CAGGGTGATCAGACAGCACCTGG - Intergenic
988645418 5:33090140-33090162 CAGGGCCACCAGACAGCTCCTGG + Intergenic
990749598 5:59000126-59000148 CAGGGTGGCCTCAGAGCTGCAGG - Intronic
991324536 5:65416017-65416039 CAGGGTGGCCATGCAGCCCCTGG - Intronic
991721031 5:69493935-69493957 CAGTGTGGCCAGCGAGCCCCGGG - Intronic
991954205 5:71976161-71976183 CAAAGTGGCCAGGGAGCTCATGG - Intergenic
992073696 5:73172173-73172195 CATGGTGGCCACACAGTTCCTGG - Intergenic
992118300 5:73564325-73564347 CAGGGTGCTCAGAGAGCTTAGGG - Intronic
992396706 5:76375259-76375281 TAGGGGAGCCAGAGAGCTCAGGG - Intergenic
994153835 5:96479885-96479907 GAGGGTGGCAAGAGCACTCCAGG + Intergenic
995417140 5:111924395-111924417 CAGTCTGGCCAGAGAGATCTTGG + Intronic
995598466 5:113772107-113772129 CAGAGTGGGCTGAGAGTTCCGGG - Intergenic
998139635 5:139692684-139692706 CAGGCCGGTCAGAGAGCTTCGGG + Intergenic
998153233 5:139769180-139769202 CATGGTGGGAAGAGGGCTCCAGG + Intergenic
998519534 5:142787126-142787148 CAGGGTGGGCACAGAACTTCTGG + Intronic
1000209333 5:159096270-159096292 CAGGGGGCGCAGGGAGCTCCAGG - Intronic
1001242030 5:170078303-170078325 AATGATGGCCAGAGGGCTCCAGG - Intronic
1001424991 5:171617132-171617154 CAGGGTGACCAGACATCCCCTGG - Intergenic
1002261268 5:177995429-177995451 CATGGTGGACAGTGAGCTCTAGG - Intronic
1002605297 5:180379590-180379612 GGGGGCGGACAGAGAGCTCCAGG - Intergenic
1002871450 6:1170267-1170289 CAGGGCAGCTAGAGAGCTACTGG + Intergenic
1002875284 6:1204497-1204519 CAGGGTGATCAGACAGCCCCGGG + Intergenic
1003075748 6:2982549-2982571 CAGGGTGATCAGACAGCCCCTGG - Intergenic
1003142662 6:3484593-3484615 CAGAGTGGAAAGAGAGCTGCTGG + Intergenic
1003778724 6:9398849-9398871 CAGGGTGCCCAGCGAGCGCAGGG + Intergenic
1003896070 6:10608945-10608967 CAGGGTGGCCAGAGAGCTCCTGG + Intronic
1005442209 6:25882205-25882227 CCGGGTTGCCAGCCAGCTCCAGG + Intronic
1006082568 6:31575803-31575825 CAGGGGGGCCCCAGGGCTCCAGG + Exonic
1006175003 6:32116376-32116398 CAGGGCATCCAGAGAGCTGCTGG - Intronic
1006471854 6:34234120-34234142 CAGGGTGGTCAGGGAAGTCCTGG - Intergenic
1006679690 6:35788061-35788083 CAGGGTGAACACAGAGCTCTGGG - Exonic
1007421857 6:41724471-41724493 CAGTGAGGCCAGAGAGGCCCAGG + Intronic
1007834659 6:44665289-44665311 GAGGGTGGCCAGGCAGCCCCCGG - Intergenic
1008572822 6:52831269-52831291 CAGGGTGGCCTGAGAGCAGAGGG + Intergenic
1008579769 6:52896235-52896257 CAGGGTGGCCTGAGAGCAGAGGG + Intronic
1010057734 6:71585548-71585570 CTGTGTGGCCAGCGACCTCCCGG - Intergenic
1010444696 6:75936881-75936903 CAGGTTGGCCAAACAGCTCCAGG + Intronic
1015440320 6:133240889-133240911 CTGGGTAGCGAGAGAGTTCCAGG + Intronic
1016891723 6:149014279-149014301 CAAGCTGGCCTGAGTGCTCCTGG - Intronic
1017758945 6:157553191-157553213 CAGGGTGGTCAGAGATTCCCTGG + Intronic
1018611653 6:165653530-165653552 CAGAAAGGCCAGAGAGCTGCAGG + Intronic
1019073897 6:169371383-169371405 CAGAGTGGCCACAGGGTTCCAGG - Intergenic
1019281191 7:201072-201094 CAGGGTGACCTGAGCTCTCCCGG + Intronic
1019437898 7:1031372-1031394 CAGGGAGGGCAGAGTGGTCCGGG + Intronic
1019437911 7:1031409-1031431 CAGGGAGGGCAGAGTGGTCCGGG + Intronic
1019437924 7:1031446-1031468 CAGGGAGGGCAGAGTGGTCCGGG + Intronic
1019437936 7:1031483-1031505 CAGGGAGGGCAGAGTGGTCCGGG + Intronic
1019437949 7:1031520-1031542 CAGGGAGGGCAGAGTGGTCCGGG + Intronic
1019437960 7:1031557-1031579 CAGGGAGGGCAGAGTGGTCCGGG + Intronic
1019437971 7:1031594-1031616 CAGGGAGGGCAGAGTGGTCCGGG + Intronic
1019437982 7:1031631-1031653 CAGGGAGGGCAGAGTGGTCCGGG + Intronic
1019437993 7:1031668-1031690 CAGGGAGGGCAGAGTGGTCCGGG + Intronic
1019438006 7:1031705-1031727 CAGGGAGGGCAGAGTGGTCCGGG + Intronic
1019438017 7:1031742-1031764 CAGGGAGGGCAGAGTGGTCCGGG + Intronic
1019438028 7:1031779-1031801 CAGGGAGGGCAGAGTGGTCCGGG + Intronic
1019438039 7:1031816-1031838 CAGGGAGGGCAGAGTGGTCCGGG + Intronic
1019438049 7:1031853-1031875 CAGGGAGGGCAGAGTGGTCCAGG + Intronic
1019789488 7:3001751-3001773 CAGGATTGCCAGAGAGCTCTTGG - Intronic
1019867163 7:3722676-3722698 CATGGTGCCCAGACAGCTGCAGG + Intronic
1019925927 7:4191745-4191767 CAGGGTGGACAGGGGGCTGCAGG + Intronic
1022662798 7:32382182-32382204 CAGGCTGGACAATGAGCTCCTGG - Intergenic
1027228826 7:76260761-76260783 GAGGGTGGACAGAGAGATTCGGG - Intronic
1027255227 7:76426548-76426570 GAGGGAGGCCAGAGAGCTGCAGG + Intronic
1028503888 7:91550209-91550231 CAGGGTGGGCAGAGATCCCATGG - Intergenic
1028828437 7:95301345-95301367 GAGGCTGGCCAGTGTGCTCCAGG + Intronic
1029180006 7:98693552-98693574 CAGGGTAACCACACAGCTCCTGG + Intergenic
1029457268 7:100677638-100677660 CAGTGTGGCCAGGCAGCTCCCGG - Exonic
1031857917 7:126944119-126944141 AAGCCTGTCCAGAGAGCTCCTGG + Intronic
1032485758 7:132286311-132286333 CAGGGTGGACAGACAGGGCCAGG - Intronic
1033289538 7:140071628-140071650 AAGGGTGGCCAGGGAACTGCCGG - Intergenic
1034545572 7:151786543-151786565 TAGGGTGGACAGAGAGCACGTGG + Intronic
1034676067 7:152893903-152893925 CAGGGTGCCCTGGGAGGTCCAGG - Intergenic
1034885606 7:154796053-154796075 AGGGTTGCCCAGAGAGCTCCAGG + Intronic
1035083826 7:156239332-156239354 AACGGTGGACAGAGAGCACCTGG + Intergenic
1035302426 7:157906268-157906290 CAGGGTGGCCACAGAGCCACTGG + Intronic
1035306495 7:157936430-157936452 TGGGGTGGCCAGAGAGCTACAGG - Intronic
1036623347 8:10443862-10443884 CAGGGTGGCCAGAGAGAGAAAGG + Intergenic
1037590490 8:20307988-20308010 CAAGGTGGTCAGAGACCTACAGG - Intergenic
1037905643 8:22714574-22714596 CAGGGTGGAGAGAGAGTGCCTGG + Intronic
1038575220 8:28699214-28699236 GAGGGTGTCCAGAGTGCTACTGG + Intronic
1039474000 8:37829825-37829847 CAGGGTGGGCAGAGGGGTCACGG - Intronic
1040841044 8:51785452-51785474 CAGGGTTGCCACAGACCTTCAGG - Intronic
1040986129 8:53296208-53296230 GAGGGTGGCCAGAGAGGGCATGG - Intergenic
1044720405 8:95140064-95140086 CAGGATGGGCAGGGAGCTCCAGG - Intronic
1045033264 8:98157675-98157697 CGGGGAGGCCGGCGAGCTCCCGG + Exonic
1045504541 8:102769219-102769241 AATGGTGGCCTGGGAGCTCCAGG - Intergenic
1047753436 8:127899790-127899812 CAAGGAAGCCAGAGAGCTCCAGG - Intergenic
1048264473 8:132973481-132973503 CAGTGTGGCATAAGAGCTCCTGG + Intronic
1048992588 8:139770057-139770079 CAGGGTGGCCAGGGTCTTCCAGG - Intronic
1049276844 8:141724268-141724290 CGGGGTGGAAAGAGAGCTCACGG + Intergenic
1049357622 8:142196505-142196527 CAGGGTGGCCCGGAAGCTCATGG + Intergenic
1050081702 9:1922272-1922294 GAGGCTGGCCAGATAGCTGCTGG + Intergenic
1050711950 9:8475195-8475217 CAGGGTGCTCAGTGATCTCCAGG + Intronic
1051775973 9:20634511-20634533 CAGGGTGACCAGACATCACCTGG + Intergenic
1053179701 9:35958032-35958054 CTGGGTGGGCAGAGAGCCTCAGG + Exonic
1054979313 9:71185768-71185790 CAGAGTGGCCATTGAGCTCAAGG - Intronic
1055447020 9:76394060-76394082 CAGGGCGGCCAGAGTCCCCCGGG - Intronic
1056313764 9:85368932-85368954 CAGAGTGGCCACAGATCTCATGG + Intergenic
1056386106 9:86098911-86098933 CAGGGCGGCCGGAGCGCGCCTGG + Intronic
1056676323 9:88679611-88679633 CAGGGTGACCAGACACCACCGGG + Intergenic
1056765210 9:89440838-89440860 CAGGGTGCCAAGAGAACTACAGG + Intronic
1056844353 9:90024718-90024740 CTGGGAGGACAGAGAGCTCTGGG - Intergenic
1056881418 9:90397188-90397210 CAGGGTAACCAGAGATCACCTGG + Intergenic
1057756851 9:97846155-97846177 CCGAGTGGTCAGAGAGCTACTGG + Intergenic
1058618940 9:106863383-106863405 CGGGGTGGTCCGAGTGCTCCGGG + Intronic
1058937544 9:109782925-109782947 CAGGGTCCCCTGAGAACTCCAGG - Intronic
1059395522 9:114031969-114031991 CAGGGTTTCCAGAGAGCACTTGG + Intronic
1059653048 9:116333411-116333433 CAGGCTGCCCAGAGCTCTCCAGG - Intronic
1060361066 9:122958204-122958226 CAAGGTGGCCAGATGGTTCCAGG - Intronic
1060742874 9:126111116-126111138 GGGGGTGGCCAGAGCTCTCCTGG + Intergenic
1060794680 9:126505816-126505838 CACAGTGGCCAGAGGGCTCGTGG - Exonic
1061052904 9:128206554-128206576 CAGGGAGGTCAGAGGTCTCCAGG + Intronic
1061061606 9:128253429-128253451 CAGAGAGGGCAGAGAGCTCGTGG + Intronic
1061089772 9:128420355-128420377 CAGGGCCGCCAGAGGGCGCCCGG + Intronic
1061713881 9:132506491-132506513 CAGGGTGCCCAGAGTCCACCAGG - Intronic
1061930943 9:133832896-133832918 CAGGGTGGACAGTGGCCTCCAGG + Intronic
1062053448 9:134458761-134458783 CTGGATGGGCCGAGAGCTCCAGG + Intergenic
1062172691 9:135144255-135144277 ACGGGTGCCCAGAGAGCACCAGG + Intergenic
1062324021 9:136003997-136004019 CAGGGTGGCCACAGTTCCCCAGG + Intergenic
1062450050 9:136611359-136611381 CAGGGGACCCAGGGAGCTCCAGG + Intergenic
1062623648 9:137433605-137433627 CAGGTGGGCCAGAAAGCCCCCGG + Exonic
1062702740 9:137916543-137916565 GAGGGTGGCTGGAGACCTCCTGG - Intronic
1185836011 X:3346483-3346505 CAGGGTGGCCAGGGCGCCCCAGG - Intronic
1188759019 X:34002387-34002409 CAGGGTGATCAGATACCTCCTGG + Intergenic
1191699401 X:64023335-64023357 CAGGGTGGCAAGATATCTGCCGG - Intergenic
1196871273 X:120115735-120115757 CATGTTGGCCAAGGAGCTCCAGG - Exonic
1196938123 X:120749731-120749753 AAGGGTGGGGAGAGAGCTGCAGG - Intergenic
1197512688 X:127390253-127390275 CAGGGTGACCACAGAGGTCCTGG + Intergenic
1198236295 X:134738598-134738620 CCGGGTGACCAGACAGCTCATGG + Intronic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1200066024 X:153504452-153504474 GAGTGTGGGCAGAGGGCTCCAGG - Intronic
1200105272 X:153708578-153708600 CAGGGTGGCCAGTGGACTCTGGG + Intronic
1200150073 X:153946999-153947021 CAGGAGGCCCAGAAAGCTCCGGG - Intergenic
1200412630 Y:2876763-2876785 CAGGGTCACCAGAGGTCTCCTGG + Intronic
1201175404 Y:11306139-11306161 CTGGGTGCCCGCAGAGCTCCGGG - Intergenic
1201176672 Y:11314141-11314163 CTGGGTGCCCGCAGAGCTCCGGG - Intergenic
1201177798 Y:11320788-11320810 CCGGGTGCCCGCAGAGCTCCGGG - Intergenic
1201240663 Y:11954327-11954349 CAGGGTGGCCAGGGTGCCCGTGG + Intergenic