ID: 1003904688

View in Genome Browser
Species Human (GRCh38)
Location 6:10688611-10688633
Sequence ATTTTATACTTGGGCATCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 0, 2: 3, 3: 63, 4: 422}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003904688 Original CRISPR ATTTTATACTTGGGCATCCA AGG (reversed) Intronic
900936083 1:5766973-5766995 ATTTTAAAGCTGGGCATCCGGGG + Intergenic
902059758 1:13632212-13632234 ATTTTAAAGCTGGGCATCCGGGG + Intergenic
902578498 1:17393773-17393795 GTTTAAGACTTGAGCATCCATGG - Intronic
902905036 1:19550222-19550244 ATTTTACAGCTGGGCCTCCAGGG + Intergenic
904714790 1:32459354-32459376 ATTTTACAGCTGGGCCTCCAGGG - Intergenic
904893533 1:33797292-33797314 ATTTTACAGCTGGGCCTCCAGGG - Intronic
904976234 1:34458899-34458921 ATTTTATTCTTTTTCATCCAGGG - Intergenic
905949346 1:41934892-41934914 ATTTTATTCTTCACCATCCATGG - Intronic
906183392 1:43840683-43840705 ATTTTAAAGCTGGGCATCCGGGG - Intronic
907506680 1:54924142-54924164 ATTTTAAAGCTGGGCATCCAGGG + Intergenic
907960637 1:59277414-59277436 TTTTTAAACCTGGGTATCCAGGG - Intergenic
909254970 1:73408266-73408288 ATTTTAAAGCTGGGCGTCCAGGG - Intergenic
909577309 1:77188735-77188757 ATTTTAAAGCTGGGCATCCAGGG - Intronic
910301804 1:85714332-85714354 ATTTTATAGCTGGGTCTCCAGGG + Intergenic
911153605 1:94618658-94618680 ATTTTAAAGCTGGGCATCCACGG + Intergenic
911279977 1:95912272-95912294 ATTTTACAGCTGGGCCTCCAGGG - Intergenic
911893725 1:103403522-103403544 ATTTTAAAGCTGGGCATCCAGGG - Intergenic
912203489 1:107484349-107484371 AATCTATACCTGGGCTTCCAAGG + Intergenic
912785749 1:112602172-112602194 ATATTATCCTTGGTCATCAAAGG + Intronic
912807208 1:112766584-112766606 ATTTTAAAGCTGGGCGTCCAGGG - Intergenic
912854928 1:113159186-113159208 ATTTTAAAGCTGGGCATCCAGGG - Intergenic
913071361 1:115301958-115301980 AATTTATACTTGGTTATCCAGGG + Intronic
915448456 1:155988548-155988570 ATTTTAAAGCTGGGCATCCGGGG - Intronic
915749532 1:158193201-158193223 ATTTTAAAGCTGGGCATCCGGGG - Intergenic
915886111 1:159722983-159723005 ATTTTAAAGTTGGGTGTCCAGGG + Intergenic
916055194 1:161064206-161064228 ATGTTAAACCTGGGCATCCAGGG - Intronic
916318953 1:163481112-163481134 ATTTTAAAGCTGGGCATCCGGGG - Intergenic
917852862 1:179080309-179080331 ATTTTCTATTTGTGCAACCATGG - Intergenic
918281480 1:183010507-183010529 ATTTAAAAGCTGGGCATCCAGGG + Intergenic
918536324 1:185578862-185578884 ATTTTACAGCTGGGCCTCCAGGG - Intergenic
918635219 1:186766277-186766299 ATTTTACAGATGGGAATCCAAGG - Intergenic
918977863 1:191513717-191513739 ATTTTACAGCTGGGCCTCCAGGG - Intergenic
919110022 1:193207092-193207114 ATTTTACAGCTGGGCCTCCAGGG + Intronic
919189942 1:194203604-194203626 ATTTTAAAGCTGGGCGTCCAGGG + Intergenic
919318517 1:196004371-196004393 ATTTTAAAGCTGGGCGTCCAGGG + Intergenic
919329960 1:196158895-196158917 AGTTTATCCATGGTCATCCACGG + Intergenic
920584107 1:207140662-207140684 ATTTTCTTCTTGGGCATGGATGG + Intronic
921894366 1:220383780-220383802 ATTTTATCTTTTGGCATCTATGG + Intergenic
921997961 1:221442199-221442221 ATTTTATAGATAGGCATTCAAGG - Intergenic
923400236 1:233609781-233609803 GTATGATACTTGGGCATCAATGG - Intergenic
923634582 1:235682316-235682338 ACTTTCTTCTTGGGCATACAGGG - Intronic
924358995 1:243215874-243215896 ATTTTAAAGCTGGGTATCCAGGG - Intronic
1063909280 10:10812947-10812969 ATTTTATAGTTGGGCAATCCTGG - Intergenic
1064154411 10:12891749-12891771 ATTGTATAGTTGGTCATGCAAGG + Intergenic
1065125061 10:22566231-22566253 ATTTTAAAGCTGGGCGTCCAGGG - Intronic
1065530199 10:26661814-26661836 ATTTTATAATTGAGCATCACTGG - Intergenic
1065556759 10:26923346-26923368 ATTTTATAATTGAGCATCACTGG + Intergenic
1065556768 10:26923601-26923623 ATTTGATGCTTTGACATCCAGGG + Intergenic
1066515505 10:36155014-36155036 GTTTTATAGTTGGCCATGCATGG - Intergenic
1067403495 10:45999434-45999456 ATTTTAAAGCTGGGCATCCGGGG + Intronic
1068097108 10:52505151-52505173 ATTTTACAGCTGAGCATCCAGGG + Intergenic
1068247713 10:54394384-54394406 ATTTTAAACCTGGGCGTCCAGGG + Intronic
1068515677 10:58022376-58022398 ATTTTAAAACTGGGCGTCCAGGG - Intergenic
1068662539 10:59637431-59637453 ATTTTAAAGCTGGGCGTCCAGGG + Intergenic
1069094448 10:64241565-64241587 ATTTTACAGCTGGGCCTCCAGGG - Intergenic
1069650283 10:70042334-70042356 ATTTTAAAGCTGGGCATCCGAGG - Intergenic
1070050372 10:72882895-72882917 ATTTTAAAGCTGGGCATCCGGGG - Intronic
1071885455 10:89944886-89944908 ATTTTGTACTTGGGTGTGCAAGG - Intergenic
1072473118 10:95732719-95732741 ATTTTAAAGCTGGGTATCCACGG + Intronic
1072867361 10:99078345-99078367 ATTAGAGACTTGAGCATCCATGG - Intronic
1072884051 10:99257843-99257865 ATTTTAAAGCTGGGTATCCAGGG - Intergenic
1073678633 10:105678138-105678160 ATTTTAAAGCTGGGCATCCGGGG - Intergenic
1074211707 10:111341257-111341279 ATTTTACAGCTGGGCCTCCAGGG + Intergenic
1075997653 10:126891589-126891611 ATTTTAAAGCTGGGCATCCGGGG - Intergenic
1077851366 11:6077008-6077030 ATTTTAAAGCTGGGTATCCAGGG - Intergenic
1078777553 11:14407687-14407709 ATTTTAAAGCTGGGCATCCAGGG - Intergenic
1079829478 11:25244809-25244831 ATTTTAAAGTTGGGCATCCGGGG + Intergenic
1081461195 11:43274308-43274330 ATTTTAAAGCTGGGCATCCGGGG + Intergenic
1081653777 11:44843252-44843274 ATTTTAAAGCTGGGCATCCGGGG + Intronic
1082300105 11:50494668-50494690 ATTTTAAAGCTGGGTATCCAGGG + Intergenic
1082919238 11:58474207-58474229 ATTTTAAAGCTGGGCATCCGGGG - Intergenic
1083092807 11:60218494-60218516 ATTTTAAAGCTGGGCATCCAGGG - Intronic
1083550115 11:63581769-63581791 ATTTTACAGCTGGGCCTCCAGGG - Intronic
1084243979 11:67843035-67843057 ATTTTAAAGCTGGGCATCCGGGG + Intergenic
1085212989 11:74798744-74798766 ATTTTAAAGATGGGCATCCAGGG - Intronic
1086261832 11:84949124-84949146 ATTTTAAAGCTGGGCATCCGGGG + Intronic
1087052837 11:93903907-93903929 ATTTTATACAGGGGCATCGGTGG - Intergenic
1087123602 11:94600364-94600386 ATTTTAAAGCTGGGCGTCCAGGG + Intronic
1089470118 11:118713914-118713936 ATTTTTTAATTGGCCAACCATGG + Intergenic
1090289549 11:125530282-125530304 ATTTAAGACTTGTGCATCAAAGG - Intergenic
1090821069 11:130342310-130342332 ATTTTCTAGTTGGGTAACCATGG - Intergenic
1094328649 12:29268792-29268814 ATTTTAAAGCTGGGCATCCGGGG + Intronic
1094385021 12:29884878-29884900 ATTTTAAAGCTGGGTATCCAGGG + Intergenic
1094416622 12:30222910-30222932 ATTTTAAAGCTGGGCATCCGGGG - Intergenic
1094605933 12:31949198-31949220 ATTTTATAGCTGGGCTGCCAGGG - Intergenic
1094674826 12:32609577-32609599 ATTTTTGACATGGGCATCTAAGG - Intronic
1094720320 12:33056285-33056307 ATTTTAAAGCTGGGCATCCGGGG - Intergenic
1095081127 12:38000877-38000899 ATTTTCTCCATGGGCATCAATGG - Intergenic
1095087200 12:38069757-38069779 ATTTTAAAGTTGGGCATCCAGGG - Intergenic
1095252966 12:39999932-39999954 ATTTTACAGCTGGGCCTCCAGGG - Intronic
1096298612 12:50405817-50405839 ATGTAAGACTTGAGCATCCAAGG - Intronic
1096431202 12:51544623-51544645 ATTTTAAAGCTGGGCATCCAGGG - Intergenic
1098039767 12:66341979-66342001 ATTTAAAACTTGGGCCTCAAAGG - Exonic
1099724542 12:86409904-86409926 ATTTTACAGCTGGGCCTCCAGGG + Intronic
1099974842 12:89535707-89535729 ATTTTAAACTTGGCCACCCTAGG + Intergenic
1100087483 12:90929420-90929442 ATTTTACAGCTGGGCAGCCAGGG + Intronic
1102231122 12:111263162-111263184 ATTTTCTACTTGTGCAAACATGG - Intronic
1102307971 12:111820833-111820855 ATTTTAAAGCTGGGCATCCGGGG + Intergenic
1105227611 13:18451100-18451122 ATTTTAAAGCTGGGCATCCAGGG + Intergenic
1105521518 13:21135404-21135426 ATTTTAAAGCTGGGCATCCGGGG + Intergenic
1106030827 13:26000902-26000924 ATTTTATAGTTTGCCATACATGG + Intronic
1106746465 13:32713989-32714011 ATTTTAAAGCTGGGCATCCAGGG + Intronic
1107020616 13:35747341-35747363 ATTTTATACTTATCCCTCCAAGG + Intergenic
1108653240 13:52502842-52502864 ATTTTACAGCTGGGCCTCCAGGG - Intergenic
1109159149 13:58950196-58950218 ATTTTACAGTTGGGTCTCCAGGG - Intergenic
1109721950 13:66286616-66286638 ATTTTAAAGTTGGGTGTCCAGGG + Intergenic
1110409046 13:75184140-75184162 ATTTTACAGCTGGGCCTCCAGGG - Intergenic
1111429459 13:88133105-88133127 ATTTTAAAGCTGGGCATCCGGGG + Intergenic
1111487135 13:88918759-88918781 ATTAAGTACTTGAGCATCCATGG + Intergenic
1111712080 13:91829725-91829747 ATTTTAAAGCTGGGCATCCGGGG + Intronic
1111744905 13:92255126-92255148 ATATGAGACTTGAGCATCCACGG + Intronic
1111899290 13:94181306-94181328 ATTTTACAGCTGGGCCTCCAGGG - Intronic
1112408445 13:99141365-99141387 ATTTTACAGCTGGGCCTCCAGGG - Intergenic
1113428179 13:110227647-110227669 ATTGTATATTTGGGAATCAAGGG - Intronic
1114012052 14:18379562-18379584 ATTTTAAAGCTGGGCATCCAGGG + Intergenic
1114215440 14:20654456-20654478 ATTTTAAAGCTGGGCATCCGGGG + Intergenic
1114349575 14:21835605-21835627 AATTTATCCATGGGCAGCCATGG + Intergenic
1114638502 14:24202912-24202934 ATTTTAAAGCTGGGCATCCGGGG - Intronic
1115291161 14:31774596-31774618 ATTTTATATTTGGGCAGATAAGG - Intronic
1115706535 14:36004961-36004983 ATTTTACAATTTGGCAACCAGGG + Intergenic
1116795816 14:49389134-49389156 ATTTTAAAGCTGGGCATCCGGGG + Intergenic
1117201478 14:53394324-53394346 ATTTTACAGTTGGGCCACCAGGG + Intergenic
1117213818 14:53529060-53529082 ATTTTATAATGGGGCATTAAGGG - Intergenic
1117382097 14:55174561-55174583 ATTTTAAAGCTGGGCATCCGGGG - Intronic
1117415892 14:55495113-55495135 ATTTTAAAGCTGGGCATCCGGGG - Intergenic
1118116311 14:62781126-62781148 ATTTTAAAGCTGGGCGTCCAGGG + Intronic
1118376126 14:65178740-65178762 ATTTTAAAGCTGGGCATCCGGGG + Intergenic
1118442366 14:65823327-65823349 ATTTAATCTTTGGGCAGCCATGG + Intergenic
1119696487 14:76717594-76717616 ACTTTCAACTTGGGGATCCATGG - Intergenic
1120397148 14:83982312-83982334 ATTTTACAGCTGGGCCTCCAGGG - Intergenic
1120637175 14:86966775-86966797 ATTTTACAGCTGGGCCTCCAGGG - Intergenic
1124248154 15:28088601-28088623 ATTTTAAAGCTGGGCATCCAGGG + Intronic
1125407693 15:39370345-39370367 ATTTTAAAGCTGGGCATCCAGGG + Intergenic
1126267224 15:46768818-46768840 ATTTTACAGCTGGGCCTCCAGGG - Intergenic
1128477232 15:68007638-68007660 ATTTTAAAGCTGGACATCCAGGG - Intergenic
1130835818 15:87648912-87648934 CTTTTAATCTTGGGCAGCCAGGG + Intergenic
1131382648 15:91976699-91976721 ATTTTAAAGTTGGGCGTCCGGGG + Intronic
1131681803 15:94731369-94731391 ATTTTATGCTTGGGCTCCCTCGG + Intergenic
1132166583 15:99597706-99597728 ATTTTAAAGCTGGGCGTCCAGGG - Intronic
1132213765 15:100047471-100047493 ATTTTAAAGCTGGGCATCCGGGG - Intronic
1133868732 16:9668451-9668473 ATTTTATACTTCAAAATCCAAGG - Intronic
1135301186 16:21328840-21328862 ATTTTAAAGCTGGGCATCCGGGG - Intergenic
1136473202 16:30495530-30495552 ATTTTATAAATGGGAATCCCTGG + Intronic
1136925393 16:34367589-34367611 ATTTTACAGCTGGGCCTCCAGGG - Intergenic
1136979181 16:35044217-35044239 ATTTTACAGCTGGGCCTCCAGGG + Intergenic
1139014183 16:62669725-62669747 ATTTTATAGATGGGCTACCAGGG - Intergenic
1139134737 16:64188503-64188525 ATTTTATACTTGGGAAGAAATGG + Intergenic
1139278640 16:65750815-65750837 ATGTGAAACTTGGGCATCCAGGG - Intergenic
1140055783 16:71524342-71524364 ATTTTAAACTTGGGATTCCTTGG + Intronic
1143943758 17:10571059-10571081 ATTTTATAGTTGCACCTCCAAGG + Intergenic
1145801181 17:27686184-27686206 ATTTTACAGCTGGGCCTCCAGGG + Intergenic
1146731890 17:35200171-35200193 ATTTTAAAGCTGGGCATCCGGGG - Intergenic
1149879205 17:60271111-60271133 ATTTTATACATGAGCATGCTCGG + Intronic
1150447406 17:65237716-65237738 ATTTTAAAGCTGGGCGTCCAGGG - Intergenic
1152398262 17:80048506-80048528 ATTCTATTCTGGGGCATCAATGG - Intronic
1153795952 18:8622406-8622428 ATTTTAAAGCTGGGCATCCAGGG + Intronic
1154047685 18:10922230-10922252 ATTTTAAAGCTGGGCATCCAGGG - Intronic
1154107591 18:11536197-11536219 ATTTTAAAGCTGGGCGTCCAGGG + Intergenic
1154525771 18:15288376-15288398 ATTTTAAAGCTGGGCATCCAGGG - Intergenic
1155774475 18:29741503-29741525 TTATTATACTTGGGCATCTCAGG + Intergenic
1156004553 18:32424314-32424336 TTTTTATACTTGTGCAAACACGG + Intronic
1156554187 18:38048637-38048659 ATTTTATAAGTGGGGAACCAAGG + Intergenic
1156649868 18:39213021-39213043 ATTTTAAAGCTGGGCGTCCAGGG + Intergenic
1156993618 18:43439909-43439931 ATTTTACAGCTGGGCCTCCAGGG - Intergenic
1159347774 18:67228691-67228713 ATTTTACAGCTGGGCCTCCAGGG - Intergenic
1160287271 18:77555667-77555689 ATCAGATACTTGAGCATCCATGG + Intergenic
1160288470 18:77568670-77568692 ATTTTACAGCTGGGCCTCCAGGG - Intergenic
1162684083 19:12367212-12367234 ATTTTACAGCTGGGCCTCCAGGG + Intergenic
1162689543 19:12417823-12417845 ATTTTACAGCTGGGCCTCCACGG - Intronic
1163263530 19:16205257-16205279 ATTTCACACCTGGGCATCTAGGG + Intronic
1164237411 19:23349318-23349340 ATTTTACAGCTGGGCCTCCAGGG - Intronic
1164276034 19:23719544-23719566 ATTTTAAAGCTGGGCATCCGGGG - Intergenic
1164377682 19:27703553-27703575 ACTTTAAACCTGGGCATCCAGGG + Intergenic
1165665464 19:37623666-37623688 ATTTTAAAGCTGGGCATCCGGGG - Intronic
1167834528 19:52056885-52056907 ATTTTACAGCTGGGCCTCCAGGG - Intronic
1168253095 19:55152013-55152035 ACTAGATACTTAGGCATCCAGGG - Intronic
926874131 2:17456569-17456591 ATTTTAAAGCTGGGCGTCCAGGG + Intergenic
927079685 2:19615208-19615230 ATTTTACAGCTGGGCAGCCATGG + Intergenic
928920764 2:36524526-36524548 ATGTCATACTTGGGAAACCAGGG + Intronic
929617129 2:43320220-43320242 ATTTTCTAGTTGGTCATTCAGGG - Intronic
930161899 2:48167045-48167067 ATTTTAAAGCCGGGCATCCAGGG + Intergenic
930557391 2:52915610-52915632 TTTTTATTTTTGGGCATTCATGG - Intergenic
931299702 2:60966264-60966286 ATTTTATACTTTTACCTCCATGG + Intronic
932071901 2:68628960-68628982 ATTTTACAGCTGGGCCTCCAGGG + Intronic
932733873 2:74240558-74240580 ATTTGATACTTGGCCAGCCTGGG + Intronic
932881817 2:75508779-75508801 ATTTTAAAGCTGGGCATCCGGGG - Intronic
933827797 2:86179277-86179299 ATCTGAGACTTGAGCATCCATGG + Intronic
935647997 2:105357505-105357527 ATATGAGACTTGAGCATCCATGG - Intergenic
936160827 2:110083141-110083163 ATTTTAAAGCTGGGCATCCAGGG - Intergenic
936183836 2:110288213-110288235 ATTTTAAAGCTGGGCATCCAGGG + Intergenic
936694380 2:114929031-114929053 ATTTTACAGCTGGGCCTCCAGGG + Intronic
936936427 2:117842656-117842678 ATTTGAAACTTGTGCATCAAAGG - Intergenic
937783588 2:125868978-125869000 AGATTATACTTGGGCTTCCCTGG - Intergenic
938524872 2:132119737-132119759 ATTTTAAAGCTGGGCATCCAGGG - Intergenic
939826555 2:147022799-147022821 ATTTTACAGCTGGGCCTCCAGGG + Intergenic
940487220 2:154311346-154311368 ATTTTAAAGCTGGGCGTCCAGGG + Intronic
941223002 2:162808071-162808093 ATATCAGACTTGAGCATCCATGG - Intronic
943346449 2:186743846-186743868 ATTTCTTACTGGGGCTTCCATGG + Intronic
943606577 2:189983868-189983890 ATTTTAAAGCTGGGCATCCAGGG + Intronic
943645201 2:190402440-190402462 ATTTTATACTTCTATATCCAGGG + Intergenic
944244910 2:197521209-197521231 ATTTTAAAGTTGGGCGTCCGGGG + Intronic
944408588 2:199414077-199414099 ACTTTTTAGTTTGGCATCCAAGG + Intronic
944848732 2:203695321-203695343 ATTATATCCTTGGGAAACCAGGG + Intergenic
945066619 2:205953048-205953070 ATTTTAAAGCTGGGCGTCCAGGG + Intergenic
945536503 2:211024915-211024937 ATTTTAAAGCTGGGTATCCAGGG + Intergenic
945897262 2:215497686-215497708 ATTTTAAAGCTGGGCGTCCAGGG - Intergenic
946125840 2:217561946-217561968 ATTTTACAGCTGGGCCTCCAGGG - Intronic
947705659 2:232273541-232273563 ATTATTTGCTGGGGCATCCAGGG + Intronic
948012907 2:234664306-234664328 ATTTTAAAGCTGGGCATCCGGGG - Intergenic
1169280662 20:4264233-4264255 ATTTTAAAGCTGGGCATCCGGGG + Intergenic
1169311018 20:4540069-4540091 ATTTTTTGCTTTGACATCCAGGG + Intergenic
1169333792 20:4738380-4738402 ATGTTCTACTCTGGCATCCAGGG - Intronic
1171777481 20:29382578-29382600 ATTTTAAAGCTGGGCATCCAGGG - Intergenic
1172154243 20:32812430-32812452 ATTTTATAGTTGGGTAAACAAGG - Intergenic
1172206906 20:33168991-33169013 ATTTTACAAATGGGCAGCCAAGG - Intronic
1172264341 20:33597935-33597957 ATTTTAAAGCTGGGCGTCCAGGG + Intronic
1173213945 20:41061885-41061907 ATTCTTAACTTGGGCTTCCATGG + Intronic
1176771656 21:13080111-13080133 ATTTTAAAGCTGGGCATCCAGGG + Intergenic
1177213320 21:18096905-18096927 ATTTTATAGCTGGGCCTCCGAGG - Intronic
1178379294 21:32094472-32094494 ATTTTAGATTTGGCCATCCCAGG + Intergenic
1178640047 21:34338166-34338188 ATTTTAAACTGTGGCTTCCATGG - Intergenic
1180155596 21:45975735-45975757 ATTTTAAAGCTGGGCATCCGGGG + Intergenic
1180436545 22:15310370-15310392 ATTTTAAAGCTGGGCATCCAGGG + Intergenic
1180518784 22:16174558-16174580 ATTTTAAAGCTGGGCATCCCAGG + Intergenic
1182894408 22:33847107-33847129 ATTTTAAAGCTGGGCATCCGGGG - Intronic
1183513768 22:38251232-38251254 ATTTTACTCTTGGGCAACCCCGG + Intronic
1184054357 22:42034326-42034348 ATTTTAAAGCTGGGCATCCGGGG + Intronic
1185164065 22:49247519-49247541 GTTGGATCCTTGGGCATCCACGG - Intergenic
951185407 3:19706936-19706958 ATTTTCTACTTTGGTATACATGG + Intergenic
951539408 3:23767903-23767925 CTTTTATAAATGGGCATCCATGG - Intergenic
951859527 3:27236569-27236591 ATTTTACAGCTGGGCCTCCAGGG + Intronic
952035655 3:29197276-29197298 ATTTAATATTTGGGCATCATTGG - Intergenic
952497733 3:33930628-33930650 ATTTTTTTCTTGGTCCTCCAAGG + Intergenic
952871153 3:37902531-37902553 ATTTTAGAATTGGGCATCCATGG + Intronic
953846608 3:46432437-46432459 ATTTTACAGCTGGGCCTCCAGGG - Intergenic
953987888 3:47459516-47459538 ATTTTACAGCTGGGCCTCCAGGG + Intronic
953994067 3:47506059-47506081 ATTTTAAAGCTGGGCATCCGGGG + Intronic
956686991 3:71838992-71839014 AATTTATGCATGGACATCCATGG - Intergenic
956715424 3:72075668-72075690 ATTTTATAGCTGGGCCTCCGGGG + Intergenic
956895881 3:73659249-73659271 ATTTTAGACTTGGGCAAACTGGG - Intergenic
957577356 3:82026599-82026621 ATTTTAGACTTGGGAATTTAAGG + Intergenic
957623032 3:82620546-82620568 ATTTTACAGCTGGGCCTCCAGGG + Intergenic
957874775 3:86131114-86131136 ATTTTAAAGCTGGGCATCCGGGG + Intergenic
958417360 3:93890553-93890575 ATTTTACAGCTGGGCCTCCAGGG - Intronic
958998941 3:100939466-100939488 ATTTTAAAGCTGGGCATCCGGGG + Intronic
959552045 3:107672194-107672216 ATTTTACACTTGGGGAGCTAAGG - Intronic
961923617 3:130452429-130452451 ATTTTAAAGCTGGGCATCCGGGG + Intronic
963176524 3:142303718-142303740 ATTTTAAAGCTGGGCATCCAGGG + Intergenic
963349672 3:144137307-144137329 ATTTTAAAGCTGAGCATCCAGGG + Intergenic
963414910 3:144983204-144983226 ATTTTAAAGCTGGGCATCCGGGG + Intergenic
963439234 3:145316171-145316193 ATTTTACAGCTGGGCCTCCAGGG + Intergenic
963519596 3:146347398-146347420 ATTTTAAAGCTGGGCATCCAGGG - Intergenic
963664067 3:148159827-148159849 ATTTTGAAGCTGGGCATCCAGGG - Intergenic
963930513 3:150999886-150999908 GTTTTATCCTTGGTCATCCTTGG + Intergenic
964099844 3:152975714-152975736 ATTTGATACTTGGCCTGCCAAGG + Intergenic
964180191 3:153874345-153874367 ATTTTACAGTTGGGCCACCAGGG + Intergenic
964880368 3:161416915-161416937 ATTTTAAAGCTGGGCATCCGGGG + Intergenic
966142631 3:176772898-176772920 ATTTTAAAGCTGGGCATCCGGGG - Intergenic
966151250 3:176869488-176869510 ATTTTAAAGCTGGGCATCCGGGG + Intergenic
967497901 3:190162515-190162537 ATTTTAAAGCTGGGCGTCCAAGG - Intergenic
967616695 3:191577602-191577624 CTTTTATGCTTGGGCATCTCTGG + Intergenic
968342373 3:197967334-197967356 ATTTTACAGCTGGGCCTCCAGGG + Intronic
969052109 4:4380325-4380347 ATTTTATACCTGGGCCAGCAGGG - Intronic
969381519 4:6802165-6802187 ATGCTATAATTGGGCATGCAAGG - Intronic
969959065 4:10924559-10924581 TATTTCTACTTGGGTATCCACGG + Intergenic
970216376 4:13763079-13763101 ATTATATACTTGGGCACTCTTGG + Intergenic
970980103 4:22086214-22086236 ATTTTACAGCTGGGCCTCCAGGG + Intergenic
971319881 4:25596933-25596955 ATTTTACAGCTGGGCCTCCACGG + Intergenic
972521128 4:39857958-39857980 ATTTTATTCTTGGCCAGGCATGG - Intronic
973223272 4:47753100-47753122 ATTTTACTGTTGGGCCTCCAGGG + Intronic
974208803 4:58743055-58743077 ATTTTAAAACTGGGCATCCGGGG + Intergenic
974605715 4:64147137-64147159 ATTTTACAGCTGGGCCTCCAGGG + Intergenic
974741458 4:66013363-66013385 ATTTTATAGCTGGGCCACCAGGG - Intergenic
974961256 4:68703734-68703756 ATTTTACAGCTGGGCCTCCAGGG - Intergenic
975587548 4:75965573-75965595 ATTTTAAAGCTGGGCGTCCAGGG - Intronic
975819205 4:78252702-78252724 ATTTTACAGCTGGGCCTCCAGGG + Intronic
975827047 4:78331001-78331023 ATTTTAAAGCTGGGCTTCCAGGG - Intronic
975954771 4:79824502-79824524 ATTTTAAAGCTGGGCATCCAGGG + Intergenic
976304549 4:83546881-83546903 ATTTCGTGCTTGGGTATCCAGGG + Intronic
976375361 4:84339656-84339678 ATTTTAAAGCTGGGCATCCGGGG + Intergenic
976816355 4:89151716-89151738 ATTTTAAAGCTGGGCATCCGGGG - Intergenic
977359100 4:95981136-95981158 AATTGATCCTTGGGCAGCCATGG - Intergenic
977388742 4:96381328-96381350 ATTTTAAAGCTGGGCATCCAGGG + Intergenic
977473555 4:97473775-97473797 ATTTTAAAGCTGGGCATCCGGGG - Intronic
977720172 4:100230663-100230685 ATTTTACACCTGGGCCACCAGGG + Intergenic
978212026 4:106148372-106148394 ATTTTAAAGCTGGGCATCCGGGG - Intronic
979027263 4:115593134-115593156 ATTTTACAGCTGGGCGTCCAGGG - Intergenic
979147569 4:117264538-117264560 ATTTTAAAGCTGGGCATCCGGGG + Intergenic
979400562 4:120244795-120244817 ATTTTATAGCTGGGCTGCCAGGG + Intergenic
979607776 4:122657247-122657269 ATCTTCAACTTGGGCTTCCAAGG + Intergenic
979970054 4:127123679-127123701 ATTTTAAAGCTGGGCATCCGGGG + Intergenic
980046608 4:127996342-127996364 ATTTTACAGCTGGGCCTCCAGGG + Intronic
980180893 4:129399369-129399391 ATTTTACAGCTGGGCCTCCAGGG + Intergenic
980278256 4:130683919-130683941 ATTTTAAAGCTGGGCATCCGGGG + Intergenic
980791733 4:137629707-137629729 TTTTTAAACCTGGGCATCCCAGG - Intergenic
981737263 4:147966138-147966160 ATATTATACTTTTGCTTCCAAGG - Intronic
983032291 4:162817907-162817929 ATTTTACAGCTGGGCCTCCAGGG - Intergenic
983884907 4:172969959-172969981 ATTTTACAGCTGGGCAGCCAGGG + Intronic
983894127 4:173063530-173063552 ATTTTAAAGCTGGGCATCCGGGG + Intergenic
984157829 4:176212755-176212777 ATTTTACAGCTGGGCCTCCAGGG - Intergenic
984509863 4:180666343-180666365 TTTTTCTATTTGGTCATCCAGGG + Intergenic
984637467 4:182126645-182126667 ATTTTATACATGTGCATATAGGG - Intergenic
985037739 4:185858118-185858140 ATTTTACAGCTGGGCCTCCAGGG - Intronic
985416214 4:189738198-189738220 ATTGTATTCGTGGGCACCCAAGG - Intergenic
985469282 5:28250-28272 ATTTTAAAGCTGGGCATCCAGGG - Intergenic
986950109 5:13072722-13072744 ATTTTACAGCTGGGCCTCCAGGG + Intergenic
987583229 5:19822525-19822547 ATTTTAAAGCTGGGCATCCGGGG + Intronic
988059149 5:26144439-26144461 ATTTTATAGTTGTCCATACATGG - Intergenic
988343474 5:30006148-30006170 ATTTTAAAGCTGGGCATCCGGGG - Intergenic
988736927 5:34031896-34031918 ATTTTAAACTTGAGAAACCAAGG + Intronic
989318958 5:40112662-40112684 ATTTTAAAGCTGGGCATCCGGGG - Intergenic
989387147 5:40865316-40865338 ATTTTACAGCTGGGCCTCCAGGG - Intergenic
989420316 5:41230787-41230809 ATTTTACAGCTGGGCCTCCAGGG - Intronic
989774359 5:45184890-45184912 ATAATAGACTTGAGCATCCATGG - Intergenic
991101329 5:62796868-62796890 ATTTTATAGCTGGGCCACCAGGG + Intergenic
991264153 5:64697048-64697070 ATTTTACAGCTGGGCCTCCAGGG - Intronic
991370700 5:65916510-65916532 ATTATATACTTTGGAAACCATGG - Intergenic
991423365 5:66464601-66464623 ATTTAAAACTTGTGCATCAAAGG + Intergenic
992467752 5:77023952-77023974 ATTTTTTTCTTGGGCCTCCAGGG + Intergenic
992955227 5:81901482-81901504 ATTTTAAAGCTGGTCATCCAGGG - Intergenic
993209087 5:84924514-84924536 ATTAGAGACTTGAGCATCCATGG + Intergenic
993834080 5:92795443-92795465 ATTTTACAGCTGGGCCTCCAGGG + Intergenic
994016565 5:94973375-94973397 ATTGTATACTAGGGAAGCCATGG + Intronic
994564192 5:101419718-101419740 ATTATTTACTTGGGCATCATTGG + Intergenic
994615399 5:102098622-102098644 ATTTTACAGCTGGGCCTCCAGGG + Intergenic
994874222 5:105394290-105394312 ATATTATTCTTCGGAATCCATGG - Intergenic
995098816 5:108272993-108273015 ATTTTAAAGCTGGGCATCCGGGG + Intronic
995104619 5:108361307-108361329 TTTTTAAGCTTTGGCATCCAAGG - Intronic
995120052 5:108526460-108526482 ATTTTAAAGCTGGGCATCCGGGG - Intergenic
995149385 5:108824892-108824914 ATTTTAAAGTTGGGCATCCGGGG + Intronic
995187369 5:109286417-109286439 ATTTTACAGCTGGGCCTCCAGGG + Intergenic
995370905 5:111418162-111418184 ATTTTAAAGCTGGGCATCCAGGG + Intronic
996100123 5:119437168-119437190 ATTTTAAACCTGGGTGTCCAGGG - Intergenic
996667243 5:126073782-126073804 ATTTTACAGTTGGGCCACCAGGG - Intergenic
997572446 5:134941421-134941443 ATTCTATACTTGGGGATTTATGG - Intronic
997920821 5:137977500-137977522 ATTTTAAAGCTGGGCATCCGGGG - Intronic
998527570 5:142856814-142856836 ATCAGATACTTGAGCATCCATGG + Intronic
999093182 5:148955426-148955448 ATTTTAAAGCTGGGCATCCAGGG + Intronic
999707195 5:154284212-154284234 ATTTTACAGTTGGGAAACCAAGG + Intronic
999901414 5:156090365-156090387 ATTTTACAGCTGGGCCTCCAGGG + Intronic
1000562700 5:162810357-162810379 ATTTTAAAGCTGGGCATCCAGGG - Intergenic
1001302106 5:170541139-170541161 ATTTTATAGATGGGAAACCAAGG - Intronic
1002509922 5:179708126-179708148 ATATTATACTGGGGCAGCCGTGG - Intronic
1002651634 5:180700885-180700907 ATTTTAAAGCTGGGCATCCAGGG - Intergenic
1002977649 6:2098823-2098845 ATCTTTTACTTGGGAATCCAAGG + Intronic
1003904688 6:10688611-10688633 ATTTTATACTTGGGCATCCAAGG - Intronic
1003931365 6:10927440-10927462 ATTTTAAAGTTGGGCATCCAGGG + Intronic
1004953176 6:20697673-20697695 ATTTTCTAATTTTGCATCCATGG - Intronic
1005132423 6:22524438-22524460 ATTTTAAAGCTGGGCATCCGAGG - Intergenic
1005324849 6:24690047-24690069 AGTTTTTACTTGGCCATCCTAGG + Intronic
1005971397 6:30764642-30764664 ATTTTAAAGCTGGGCATCCGGGG + Intergenic
1006041927 6:31263282-31263304 ATTTTACAGTTGGGCCACCAGGG + Intergenic
1007216277 6:40241856-40241878 ATCTGGTACTTGAGCATCCATGG + Intergenic
1007354003 6:41297182-41297204 ATTTTAGAGCTGGGCCTCCAGGG + Intergenic
1008167239 6:48153204-48153226 ATTTTACAGCTGGGCCTCCAGGG - Intergenic
1008585519 6:52944855-52944877 ATTTTAAAGCTGGGCATCCGGGG - Intergenic
1009536267 6:64890442-64890464 ATTTTAAAGCTGGGCGTCCAGGG - Intronic
1009544203 6:65003649-65003671 ATTTTAAAGCTGGGCATCCGGGG - Intronic
1009840421 6:69066041-69066063 ATAAGATACTTGAGCATCCATGG + Intronic
1009948863 6:70371904-70371926 ATTTTATAATTTGTCATACATGG + Intergenic
1010465095 6:76158347-76158369 ATTTTACAGCTGGGCCTCCAGGG - Intergenic
1010489742 6:76461220-76461242 ATTTTAAAGCTGGGCATCCGGGG + Intergenic
1011066133 6:83327859-83327881 ATTTTAAAGCTGGGCATCCGGGG - Intronic
1011878382 6:91991805-91991827 ATTTTATACTTGAGACTCCCAGG - Intergenic
1012143461 6:95651781-95651803 ATTTTAAAGCTGGGCATCCGGGG - Intergenic
1012380706 6:98616200-98616222 ATTTTAAACCTGGGTGTCCAGGG + Intergenic
1012909761 6:105105386-105105408 ATGTTATACTTGGCCCTCAATGG - Intronic
1012960300 6:105615182-105615204 ATTTTAAAGCTGGGCGTCCAGGG + Intergenic
1013884480 6:114945698-114945720 AACTTCTACCTGGGCATCCAGGG + Intergenic
1013949587 6:115763876-115763898 ATTTCATACGTGGGTATCAAGGG + Intergenic
1015206399 6:130644584-130644606 ATTTTAAAGTTGGGTGTCCAGGG + Intergenic
1015545382 6:134356296-134356318 ATTTTAAAGCTGGGCATCCGAGG - Intergenic
1016126723 6:140412630-140412652 ATTTTATTCTTTGGTTTCCATGG - Intergenic
1017130698 6:151106230-151106252 ACTTTGTCCATGGGCATCCAAGG + Intergenic
1017177524 6:151518738-151518760 ATTTTACAGCTGGGCCTCCATGG + Intronic
1018985220 6:168631178-168631200 ATTTTAAAGCTGGGCATCCGGGG - Intronic
1020788949 7:12602150-12602172 ATTTTACAACTGGGCCTCCAGGG + Intronic
1020909291 7:14108629-14108651 ATTTTAAAGCTGGGCATCCGGGG + Intergenic
1024497384 7:50064122-50064144 ATTTTAAAGCTGGGCATCCGGGG + Intronic
1024586469 7:50846077-50846099 ATTTTAAAGCTGGGCATCCGGGG - Intergenic
1024694913 7:51846022-51846044 ATTTTACAGTTGGGCCACCAGGG - Intergenic
1025036551 7:55596781-55596803 ATTTTATAATTGGGGGTACAGGG + Intergenic
1025600109 7:62986365-62986387 ATTTTAAAGCTGGGCATCCGGGG + Intergenic
1025722920 7:64032795-64032817 ATTTTACAGCTGGGCCTCCAGGG + Intronic
1025760117 7:64381797-64381819 ATTTTAAAGCTGGGCATCCGGGG - Intergenic
1027509025 7:79055418-79055440 ATCTGATACTTGGGCATCATTGG - Intronic
1027567480 7:79814725-79814747 ATTTTATACTTGGGGAAACTGGG + Intergenic
1027653038 7:80894859-80894881 ACTTATTACTTGTGCATCCATGG - Intronic
1027745718 7:82071446-82071468 ATTATATATTTGGGCAGCAATGG + Intronic
1027793191 7:82658565-82658587 ATTTTAAAGCTGGGCATCCAGGG + Intergenic
1028014608 7:85691196-85691218 ATTTTATATTTGGTAATCCCAGG - Intergenic
1028786996 7:94806995-94807017 ATTTTAAAGCTGGGCATCCAGGG + Intergenic
1029949345 7:104566480-104566502 TATTTATACAAGGGCATCCAGGG + Intronic
1030601467 7:111597597-111597619 ATTTTAAAGCTGGGCATCCAGGG - Intergenic
1030618220 7:111761031-111761053 ATTTTATAATTGGGGAACCAGGG + Intronic
1031636189 7:124103828-124103850 ATTTTAAAGCTGGGCATCCGGGG - Intergenic
1031773009 7:125869790-125869812 ATTTTATTCTAGGCCTTCCAAGG + Intergenic
1031838286 7:126705056-126705078 ATTTTAAAGCTGGGCGTCCAGGG - Intronic
1031930425 7:127680052-127680074 ATTTTAAAGCTGGGCATCCGGGG + Intronic
1033716720 7:144010076-144010098 ATTTTACAGCTGGGCCTCCAGGG + Intergenic
1033859496 7:145607261-145607283 ATTTTAAAGCTGGGCATCCGGGG - Intergenic
1034609455 7:152352545-152352567 ATTTTAAAGCTGGGCATCCGGGG - Intronic
1034784664 7:153914809-153914831 GTTTTATACTTGACCATGCATGG - Intronic
1035135235 7:156697077-156697099 ATTTTATAGCTGGGCCGCCAGGG + Intronic
1035686842 8:1529815-1529837 ATTTTAAAGCTGGGCATCCGGGG + Intronic
1036118375 8:5986642-5986664 ATTTTACAGGTGGGCCTCCAGGG + Intergenic
1036367597 8:8134558-8134580 ATTTTAAAGTTGGGTATCCGGGG - Intergenic
1036495912 8:9269792-9269814 ATTTTAAAGCTGGGTATCCAGGG + Intergenic
1036883283 8:12531103-12531125 ATTTTAAAGTTGGGTATCCGGGG + Intergenic
1037327177 8:17704019-17704041 ATTTTACAGCTGGGCCTCCAGGG - Intronic
1038456723 8:27676620-27676642 ATTATATTCTTGGTCATCCTGGG - Intronic
1038786518 8:30622279-30622301 ATTTTAAAGCTGGGCGTCCAGGG + Intronic
1039137016 8:34336384-34336406 AGTTTATACTTGTGGATGCAAGG + Intergenic
1039183072 8:34888104-34888126 ATTTTACAGCTGGGCAGCCAGGG + Intergenic
1039669368 8:39579312-39579334 ATTTTACACCTGGGCCTCCAGGG - Intergenic
1040127451 8:43754161-43754183 GTTTTTTACTTGGGCCTCAATGG - Intergenic
1040425999 8:47287039-47287061 ATTTTACAGCTGGGCCTCCAGGG + Intronic
1040720186 8:50311153-50311175 ATTTTATACTTGGCTATCTAAGG + Intronic
1040795899 8:51289768-51289790 ATTTTACAGCTGGGCCTCCAGGG + Intergenic
1041010617 8:53538961-53538983 ATTTTACAGCTGGGCCTCCAGGG - Intergenic
1041033906 8:53767072-53767094 ATTTTAAAGCTGGGCATCCGGGG - Intronic
1041541758 8:58992938-58992960 TTTCTTTACTTGGGTATCCAGGG - Intronic
1041860086 8:62503201-62503223 ATTTTATAATTGGGCCACCAGGG + Intronic
1041922382 8:63196677-63196699 ATTTTAAATTTGAGTATCCAGGG - Intronic
1042999709 8:74742922-74742944 ATTTTATACCATGACATCCAAGG - Intronic
1043159026 8:76822375-76822397 ATTTTATACTTGTGATTCCAAGG + Intronic
1043281398 8:78471144-78471166 ATTTTACAGCTGGGCCTCCAGGG - Intergenic
1043750845 8:83931675-83931697 ATTTTACAGCTGGGCCTCCAGGG - Intergenic
1043977547 8:86600017-86600039 ATTTTAAAGTTGGGTGTCCAGGG - Intronic
1044307751 8:90657313-90657335 ATTTTACAGCTGGGCCTCCAGGG + Intronic
1044413934 8:91915076-91915098 ATCTTATACTTGGCCAGGCATGG + Intergenic
1046162427 8:110385183-110385205 ATTTGATAATTGGGCAACCATGG - Intergenic
1046282534 8:112052885-112052907 ATTTTACAGCTGGGCTTCCAGGG + Intergenic
1046639452 8:116710783-116710805 ATTTTAAACTTGGGCATCTCTGG + Intronic
1047287265 8:123498216-123498238 ATTCTATACTTGGGAATCCTTGG - Exonic
1047574110 8:126134208-126134230 ATTTTATTAATGGGCATCCATGG - Intergenic
1047994576 8:130321658-130321680 ATTTTATATTTAAGCAACCATGG - Intronic
1048200656 8:132371432-132371454 ACTTTATACATGGGCAGTCAGGG + Intronic
1048479095 8:134771212-134771234 ATTTTAAAGCTGGGCATCCGGGG - Intergenic
1050187931 9:2994802-2994824 AATTTATCCTTGGTCCTCCAAGG - Intergenic
1050817416 9:9833263-9833285 ATTTTAAAGCTGGGCATCCGGGG + Intronic
1051668624 9:19488632-19488654 ATATTATACCTGGGCTGCCATGG - Intergenic
1052009444 9:23388805-23388827 ATTTTAAAGCTGGGTATCCAGGG + Intergenic
1052354931 9:27494439-27494461 ATTTTAAAGCTGGGCATCCAAGG - Intronic
1053651556 9:40175082-40175104 ATTTTAAAGCTGGGCGTCCAGGG + Intergenic
1053703618 9:40727342-40727364 ATTTTAAAGCTGGGCATCCAGGG - Intergenic
1054413678 9:64850806-64850828 ATTTTAAAGCTGGGCATCCAGGG - Intergenic
1055830405 9:80371803-80371825 ATTTTAAAGCTGGGCATCCGGGG + Intergenic
1057099200 9:92341460-92341482 ATTTTAAAGCTGGGCGTCCAGGG - Intronic
1057145360 9:92755529-92755551 ATTTTAAAGCTGGGCATCCGGGG - Intronic
1058268480 9:102937581-102937603 ATTTTAAAGCTGGGCATCCAGGG - Intergenic
1058542922 9:106030700-106030722 ATTTTATAGCTGGGCCGCCAGGG - Intergenic
1058922672 9:109632168-109632190 ATTTTAAAGCTGGGCATCCCGGG - Intergenic
1058975023 9:110118044-110118066 ATTTTCTACATGTGCCTCCATGG - Intronic
1059198349 9:112392049-112392071 ATTTTACAGCTGGGCCTCCAGGG + Intronic
1061104610 9:128519851-128519873 ATTTTAAAGCTGGGCATCCGGGG - Intronic
1203636854 Un_KI270750v1:120842-120864 ATTGTATTCGTGGGCACCCAAGG + Intergenic
1186132120 X:6479063-6479085 ATTTTAAAGCTGGGCATCCGGGG - Intergenic
1186568744 X:10692287-10692309 ATTTTACAGCTGGGCCTCCAGGG - Intronic
1187685087 X:21808050-21808072 ATTTTACAGCTGGGCCTCCAGGG + Intergenic
1188424995 X:30036326-30036348 ATTTTACAGCTGGGCCTCCAGGG + Intergenic
1189003318 X:36968575-36968597 TTTTTATACTTGAGCCTCAAAGG + Intergenic
1189046319 X:37595312-37595334 TTTTTATACTTGAGCCTCAAAGG - Intronic
1189509564 X:41648573-41648595 ATTTTAAAGCTGGGCATCCAGGG - Intronic
1190002054 X:46698322-46698344 ATTTTAAAGCTGGGCATCCGGGG - Intronic
1190616348 X:52236877-52236899 ATTTTAAAGCTGGGCGTCCAGGG - Intergenic
1191148442 X:57193603-57193625 ATTTTAAAGCTGGGCATCCGGGG - Intergenic
1191980905 X:66924320-66924342 ATTTTAAAGCTGGGCATCCGGGG - Intergenic
1192077682 X:68016998-68017020 ATTTTAAAGCTGGGCATCCGGGG - Intergenic
1192675539 X:73192181-73192203 ATTTTACAGCTGGGCCTCCAGGG + Intergenic
1192752172 X:74004850-74004872 ATTTTAAAGCTGGGCATCCTGGG + Intergenic
1192842453 X:74871206-74871228 ATTTTATAGCTGGGCCTCCGGGG + Intronic
1193441443 X:81544223-81544245 ATTTTACAGCTGGGCCTCCAGGG - Intergenic
1193753848 X:85382025-85382047 ATTTTACACTTGAAAATCCAAGG + Intergenic
1194042311 X:88956623-88956645 ATTTTACAGCTGGGCCTCCAGGG - Intergenic
1194440587 X:93928871-93928893 ATTTTACAGCTGGGCCTCCAGGG + Intergenic
1195300298 X:103523796-103523818 ATTTTAAACATGGGCCTCAAGGG + Intergenic
1196899496 X:120368851-120368873 AAGTAATACTTGGACATCCAGGG + Intronic
1197549226 X:127867408-127867430 ATTTTATAGCTGGGCCTCCGAGG - Intergenic
1197628674 X:128832704-128832726 ATTTTACAGCTGGGCCTCCAGGG - Intergenic
1197795282 X:130291594-130291616 ATTTTATAGCTGGGCCTCCAGGG + Intergenic
1198072638 X:133164659-133164681 ATTTTAAAGCTGGGCATCCGGGG + Intergenic
1198857252 X:141031657-141031679 ATTTTACAGTTGGGCCGCCAGGG + Intergenic
1198905443 X:141555709-141555731 ATTTTACAGTTGGGCCGCCAGGG - Intergenic
1199989307 X:152976399-152976421 ATTTTATAGCTGGGCCTCCGGGG + Intergenic
1200950504 Y:8894188-8894210 ATTTTAAAGCTGGGCATCCGGGG - Intergenic
1201478438 Y:14410408-14410430 ATTTTAAAGCTGGGCATCCGGGG + Intergenic
1201768765 Y:17597324-17597346 ATTTTAAAGCTGGGCATCCAGGG - Intergenic
1201832789 Y:18308661-18308683 ATTTTAAAGCTGGGCATCCAGGG + Intergenic