ID: 1003906252

View in Genome Browser
Species Human (GRCh38)
Location 6:10702407-10702429
Sequence TTAATCAGTGGAGCGGAAGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 97}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003906246_1003906252 21 Left 1003906246 6:10702363-10702385 CCATAGGTACAATAACTTGCCTG 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1003906252 6:10702407-10702429 TTAATCAGTGGAGCGGAAGATGG 0: 1
1: 0
2: 0
3: 5
4: 97
1003906249_1003906252 2 Left 1003906249 6:10702382-10702404 CCTGAAATTCTATGGCAACAGGC 0: 1
1: 0
2: 1
3: 10
4: 120
Right 1003906252 6:10702407-10702429 TTAATCAGTGGAGCGGAAGATGG 0: 1
1: 0
2: 0
3: 5
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003906252 Original CRISPR TTAATCAGTGGAGCGGAAGA TGG Exonic
905827412 1:41036399-41036421 TTAATCAGATGTGAGGAAGAAGG - Intronic
910685486 1:89911900-89911922 TTCAGCAGAGGAGAGGAAGAAGG - Intronic
911077609 1:93893374-93893396 TTCATCAGAGGAGGGGGAGATGG - Intronic
911246537 1:95524681-95524703 TTAGTCAGTTGAGAGGGAGATGG - Intergenic
914377244 1:147082744-147082766 TTCATCAGAGGAGCAAAAGAGGG - Intergenic
916763051 1:167834202-167834224 TTAATCAGTGGAGCTGGGGATGG - Intronic
917693944 1:177499597-177499619 TAAACCAGTGGAACAGAAGATGG + Intergenic
917838432 1:178958865-178958887 TTAATAGGTGGAGAGGATGAGGG - Intergenic
919273891 1:195386393-195386415 TAAATCATTGGAGCAGAAAAAGG - Intergenic
1065282188 10:24150849-24150871 TTGATCACTGGAACTGAAGAGGG + Intronic
1070818695 10:79342016-79342038 TTAGTCAGTGGAGGTTAAGAGGG + Intergenic
1071092951 10:81941393-81941415 TTTCTGAGTGGAGAGGAAGATGG + Intronic
1076223596 10:128755520-128755542 TTAATCACTTTAGAGGAAGAGGG + Intergenic
1077615751 11:3672268-3672290 TGACCCAGTGGAGCAGAAGATGG + Intronic
1078426637 11:11256376-11256398 TAAACCAATGGAGCGGAATAGGG - Intergenic
1080405374 11:31973924-31973946 TTGATCAGTGGATCAGAAGCTGG - Intronic
1081808537 11:45902749-45902771 TCCATCAGTGAAGAGGAAGAGGG + Exonic
1087896682 11:103594183-103594205 TAAACCAGTGGAGAGGGAGAAGG + Intergenic
1089830855 11:121326617-121326639 TTAAACAGAGGAGGTGAAGAGGG - Intergenic
1091073278 11:132589229-132589251 TTAAACAGTGTAGAGGAAGTTGG - Intronic
1091715150 12:2771656-2771678 TGACTCAGTGGAGCGAAAGACGG - Intergenic
1093621119 12:21290469-21290491 TAAATCTGTGGAGCAGAATAAGG + Intronic
1093639053 12:21503890-21503912 TTATTCAGAGGGGCGGAGGAGGG + Intronic
1095864192 12:46953755-46953777 TCAATCATTGGAAAGGAAGAAGG + Intergenic
1098465978 12:70785899-70785921 ATAATCAGGGGAGTGGAAGGTGG - Intronic
1099296198 12:80830951-80830973 TTAATCAGTACAGCGTAAGGAGG - Intronic
1101708268 12:107241118-107241140 GTAATCAGAGGAGTGGAAGGTGG - Intergenic
1104607699 12:130202181-130202203 TCAACCAGTGGAGTGAAAGAGGG + Intergenic
1112362829 13:98732501-98732523 TTATTGAGTCGTGCGGAAGAGGG - Intronic
1113432492 13:110262720-110262742 TTAATCAGTGCAGCAGAATCAGG - Intronic
1115051387 14:29068030-29068052 TAAACCACTGGAGCGGCAGATGG - Intergenic
1118885996 14:69866244-69866266 TTGATCCCTGGAGAGGAAGAAGG - Intronic
1122752729 14:103950419-103950441 TTAATCATTGTGGTGGAAGAAGG - Intronic
1124089224 15:26582091-26582113 TTAATCATTTGAGTGGAAGAAGG - Intronic
1126240856 15:46441588-46441610 TGAATGGGTGGAGAGGAAGAAGG + Intergenic
1133242044 16:4420471-4420493 TTAAGGAGTGGAGTGGATGATGG - Intronic
1135723262 16:24834606-24834628 CTGATCAGTGGAGGGAAAGAAGG + Intergenic
1140326904 16:74013277-74013299 TTAATCACTGGAGCAGTACAAGG + Intergenic
1147127122 17:38378760-38378782 ATAATCTGTGGAGGGCAAGAGGG + Intronic
1150930027 17:69574734-69574756 TTATTCAAAGGAGCGGAAGCTGG + Intergenic
1151810981 17:76441777-76441799 TTTATCAGTGGAGGGGGAGGGGG - Intronic
1160900183 19:1424092-1424114 TCAGTCAGTGGAGAGGAAGAGGG - Intronic
925804183 2:7632054-7632076 TTAATCAGTGTAGAAGAAAAAGG + Intergenic
926997277 2:18749770-18749792 TTAATCACTGGAGATAAAGAAGG - Intergenic
930077011 2:47414584-47414606 TTAAAAAGTGGAGTGGAGGAGGG - Intronic
936774761 2:115959637-115959659 TAAATCAGTGGAACAGAATAGGG - Intergenic
938752267 2:134343980-134344002 ATAAACAGGGGAGAGGAAGAAGG + Intronic
941696946 2:168562996-168563018 TTAGTCAGAGGAGGGAAAGATGG - Intronic
945204473 2:207317432-207317454 TTAATCATTGTGGTGGAAGAAGG + Intergenic
945547877 2:211180481-211180503 TTTAGCAGTGGAGGTGAAGATGG + Intergenic
946908388 2:224437557-224437579 TGAATATGTGGAGAGGAAGAGGG - Intergenic
948317587 2:237040633-237040655 TCAGTCAGTGTAGCGGGAGATGG - Intergenic
948425152 2:237882740-237882762 GTAACTAGTGGAGGGGAAGAGGG + Intronic
1169919275 20:10717123-10717145 TGAATCACAGGAGTGGAAGATGG + Intergenic
1170911372 20:20573321-20573343 TAGATCAGGGGAGAGGAAGAGGG + Intronic
1172090402 20:32427698-32427720 TCAATGAGTTGAGCGAAAGACGG - Intronic
1172650331 20:36497761-36497783 TGAAGCAGTGGAGGGGAAGCTGG - Intronic
1183235509 22:36614015-36614037 GTAATCAGTGGTAGGGAAGAGGG - Intronic
950371667 3:12536116-12536138 TGAGTCAGTGGAGGAGAAGAAGG + Intronic
952824246 3:37511715-37511737 GTAATCAGAGGGGAGGAAGATGG + Intronic
954992830 3:54855754-54855776 TTAATCACTTGAGCAGAAGGGGG - Intronic
957637343 3:82803439-82803461 TTAATCAGTGGTTCTGAATAAGG - Intergenic
960239224 3:115320640-115320662 TTGATCAGAGGAGGGAAAGAAGG + Intergenic
966513127 3:180786384-180786406 TGAATCAGTGGACTGGGAGAGGG + Intronic
968277651 3:197452956-197452978 TTTATCAGTGGAATGAAAGAAGG + Intergenic
973151806 4:46897664-46897686 TTGAGCAGTGGAGAGGAAGGAGG - Intronic
974419719 4:61657871-61657893 ATAAACATTGGAGAGGAAGAGGG + Intronic
978084805 4:104637839-104637861 TTAATAAGTGGATAGGAATAAGG - Intergenic
980505983 4:133722185-133722207 CTAATCAGTGGAATTGAAGATGG - Intergenic
981036423 4:140174218-140174240 TTAATCAATGGAACAGAATAGGG - Intergenic
981444458 4:144819601-144819623 CTAATCTGTGGAGAGGAGGATGG - Intergenic
982318257 4:154053186-154053208 TAAAACAGTGGAGCAGAATAGGG - Intergenic
982527810 4:156502017-156502039 ATCATGAGTGGAGAGGAAGAGGG - Intergenic
984604072 4:181764339-181764361 TTATGCAGTGGAGTGGAAGCAGG - Intergenic
985061871 4:186088231-186088253 TCAATGAGTGGAGAAGAAGATGG + Intergenic
985661509 5:1159372-1159394 TTGAGCAGTGGATGGGAAGAAGG + Intergenic
991400749 5:66248875-66248897 TGAGCCAGTGGAGTGGAAGAGGG - Intergenic
992140392 5:73790885-73790907 TTACTAAGTGGAGAGGAAAAGGG + Intronic
995809495 5:116088702-116088724 TTACTCAGTAAAGGGGAAGAAGG - Intronic
995839071 5:116426088-116426110 TTAATCAGTGGAATAGAATAAGG + Intergenic
1003906252 6:10702407-10702429 TTAATCAGTGGAGCGGAAGATGG + Exonic
1015296057 6:131594485-131594507 TTAATCTGAGGAGAGGCAGAAGG + Intronic
1015652009 6:135473282-135473304 TAAATCAGTAGAGCAGAATAGGG - Intronic
1020777417 7:12472143-12472165 TTCATCAGAGGAGCAAAAGAGGG + Intergenic
1022047847 7:26637328-26637350 TTACCCAGTGGAGGAGAAGAAGG + Intergenic
1024523494 7:50328302-50328324 TTAACCAGTGGAGTTGCAGATGG - Intronic
1027603408 7:80269072-80269094 AGAATCAGTGAAGAGGAAGAAGG - Intergenic
1029321581 7:99766072-99766094 TTATTCAGTGGATCTGAAGGAGG + Intronic
1039582745 8:38680368-38680390 TGATTCAGTGGAGCTGCAGAAGG + Intergenic
1039848433 8:41342524-41342546 TTAATCATTAGATCGGAAAAGGG + Intergenic
1041388784 8:57330871-57330893 ATAATTATTGGAGCGGAAAAGGG - Intergenic
1046702567 8:117418088-117418110 TTTAGCACTGGAGGGGAAGATGG + Intergenic
1049047252 8:140162579-140162601 TAATTCAGTTGAGGGGAAGAGGG + Intronic
1050711318 9:8467975-8467997 TTGATCAGTGAAGTAGAAGAGGG - Intronic
1051929138 9:22364124-22364146 TTAGTCAGTGGAGGTGAAGTGGG + Intergenic
1058588279 9:106533200-106533222 TCAATCAGTAGAGGAGAAGATGG - Intergenic
1059775609 9:117471825-117471847 TTAAACATTGGAGAGGAAGTTGG + Intergenic
1187223321 X:17351875-17351897 AGAATCAGTGGATGGGAAGAAGG - Intergenic
1187781096 X:22825870-22825892 TTAATCAGTGGTGAGGAGGAAGG + Intergenic
1189079111 X:37950877-37950899 TTAATCAGTGCAGCACATGATGG + Intronic
1192305652 X:69956882-69956904 TTGTACAGTGGAGGGGAAGATGG + Intronic
1196742501 X:119037487-119037509 ATAATCACTGGAGAGGCAGAAGG - Intergenic
1199701654 X:150382319-150382341 TAGATCAGTGGAGCAGAATAAGG - Intronic