ID: 1003906252

View in Genome Browser
Species Human (GRCh38)
Location 6:10702407-10702429
Sequence TTAATCAGTGGAGCGGAAGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 97}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003906246_1003906252 21 Left 1003906246 6:10702363-10702385 CCATAGGTACAATAACTTGCCTG 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1003906252 6:10702407-10702429 TTAATCAGTGGAGCGGAAGATGG 0: 1
1: 0
2: 0
3: 5
4: 97
1003906249_1003906252 2 Left 1003906249 6:10702382-10702404 CCTGAAATTCTATGGCAACAGGC 0: 1
1: 0
2: 1
3: 10
4: 120
Right 1003906252 6:10702407-10702429 TTAATCAGTGGAGCGGAAGATGG 0: 1
1: 0
2: 0
3: 5
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003906252 Original CRISPR TTAATCAGTGGAGCGGAAGA TGG Exonic