ID: 1003911491

View in Genome Browser
Species Human (GRCh38)
Location 6:10747768-10747790
Sequence CCCCGGGGCCGCGGCAGGGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 730
Summary {0: 1, 1: 0, 2: 4, 3: 68, 4: 657}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003911491_1003911501 15 Left 1003911491 6:10747768-10747790 CCCGCCCTGCCGCGGCCCCGGGG 0: 1
1: 0
2: 4
3: 68
4: 657
Right 1003911501 6:10747806-10747828 ATCGCGTTTCCGGAGAGACCTGG 0: 1
1: 0
2: 0
3: 1
4: 16
1003911491_1003911500 5 Left 1003911491 6:10747768-10747790 CCCGCCCTGCCGCGGCCCCGGGG 0: 1
1: 0
2: 4
3: 68
4: 657
Right 1003911500 6:10747796-10747818 CGCGCACGCAATCGCGTTTCCGG 0: 1
1: 0
2: 0
3: 0
4: 5

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003911491 Original CRISPR CCCCGGGGCCGCGGCAGGGC GGG (reversed) Exonic