ID: 1003911491

View in Genome Browser
Species Human (GRCh38)
Location 6:10747768-10747790
Sequence CCCCGGGGCCGCGGCAGGGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 730
Summary {0: 1, 1: 0, 2: 4, 3: 68, 4: 657}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003911491_1003911500 5 Left 1003911491 6:10747768-10747790 CCCGCCCTGCCGCGGCCCCGGGG 0: 1
1: 0
2: 4
3: 68
4: 657
Right 1003911500 6:10747796-10747818 CGCGCACGCAATCGCGTTTCCGG 0: 1
1: 0
2: 0
3: 0
4: 5
1003911491_1003911501 15 Left 1003911491 6:10747768-10747790 CCCGCCCTGCCGCGGCCCCGGGG 0: 1
1: 0
2: 4
3: 68
4: 657
Right 1003911501 6:10747806-10747828 ATCGCGTTTCCGGAGAGACCTGG 0: 1
1: 0
2: 0
3: 1
4: 16

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003911491 Original CRISPR CCCCGGGGCCGCGGCAGGGC GGG (reversed) Exonic
900113610 1:1019774-1019796 CCGGGGGGCCGCGGCGGGGGAGG + Intergenic
900138865 1:1130713-1130735 CCTCGGGCCTGGGGCAGGGCTGG + Intergenic
900323449 1:2095972-2095994 GCCAGGGGCCAGGGCAGGGCTGG + Intronic
900363368 1:2300506-2300528 CCCAGGGGCCTTGGTAGGGCGGG + Intronic
900373581 1:2343405-2343427 CCGCCTGGCCCCGGCAGGGCTGG - Intronic
900411583 1:2514962-2514984 CTCCGGGTCCTGGGCAGGGCTGG + Intronic
900414006 1:2526776-2526798 GCCCGGGGCTGCGGGCGGGCGGG + Intergenic
900427451 1:2587030-2587052 CCGCGGGGCCTGGGCGGGGCTGG + Intronic
900604385 1:3517254-3517276 CCAGGAGGCTGCGGCAGGGCTGG + Intronic
900635069 1:3659228-3659250 CCTGGGGGCCGTGGCGGGGCAGG + Intronic
900744632 1:4352747-4352769 CCGCAGGTCCGCAGCAGGGCTGG - Intergenic
900898993 1:5504139-5504161 CCCTGGGGCTGGGGCAGGTCTGG + Intergenic
901109767 1:6785423-6785445 CCGCGGGGCGGGGCCAGGGCGGG + Exonic
901317365 1:8318119-8318141 AGCCGGGACCGCGGCCGGGCAGG + Intronic
901433996 1:9235081-9235103 GGCCGGGGCGGCGGCGGGGCCGG - Intronic
901506580 1:9689455-9689477 CCTCGGGGCTGGGGCGGGGCCGG - Intronic
901823000 1:11842208-11842230 CACCGGGGCAGCCTCAGGGCAGG - Exonic
902585736 1:17437959-17437981 GCCCGGGCCCGCGGCGGGGGAGG - Intronic
903282535 1:22258099-22258121 CCACGGGGCAGCCGCAGGCCAGG + Intergenic
903555032 1:24187162-24187184 GCGCGGGGCCGCGGGAGGGAGGG - Intronic
904318303 1:29680234-29680256 CCCCTGGCCCGCCGCAGGGGTGG + Intergenic
904339466 1:29824761-29824783 CCCCAGGCCAGAGGCAGGGCAGG + Intergenic
904384330 1:30131670-30131692 CCCCTGGGCTGCTGCAGGGCGGG + Intergenic
904775087 1:32901431-32901453 CCGCGGGGGCGCTGCGGGGCCGG - Intronic
905212763 1:36385793-36385815 CCGGGGGGCCGGGGCCGGGCTGG + Exonic
905272872 1:36798208-36798230 TCCCAGGGCCTCGGCAGGGGCGG + Exonic
905375056 1:37514543-37514565 CTCCGGGGGCGCGGCGCGGCGGG - Intronic
905406370 1:37735296-37735318 CCCAGGGGCTCCGGCAGGGATGG + Exonic
905461695 1:38126531-38126553 CCCCGGGGACCCAGCAGGGGTGG - Intergenic
905881563 1:41467484-41467506 GCCCGGGGCTGCAGCTGGGCTGG + Intergenic
906062534 1:42958184-42958206 CGCCGGGGCCGGGGCCGGGCCGG + Intronic
906545510 1:46616871-46616893 CCCCGTGGCCGCGGCGTGGCGGG - Intronic
906795452 1:48693194-48693216 CCCCGGACCCTGGGCAGGGCTGG + Intronic
907277668 1:53326278-53326300 GGGCGGGGCCGGGGCAGGGCAGG + Intronic
908401308 1:63774671-63774693 CCCCGGAGCCCCGCCAGGCCAGG + Intronic
908501021 1:64744632-64744654 CCCCCGGGCCGCCCCAGCGCGGG + Intergenic
909392925 1:75136437-75136459 CCCGGGCGCCGCGGGCGGGCTGG - Intronic
910372929 1:86537260-86537282 CCATGGGCGCGCGGCAGGGCAGG - Intergenic
912569023 1:110608028-110608050 CCCCAGGGCCCGGGCAGGGAAGG + Intronic
914197388 1:145454542-145454564 CCCAGCGGCCCCGGCAGGGAGGG + Intergenic
915213448 1:154325898-154325920 TCCCGGGGACGGGGCAGAGCGGG + Intronic
915333177 1:155126164-155126186 CCCCGTGGCCGGGTCAGGGCCGG - Intergenic
915341375 1:155178661-155178683 CCCCGGGCCCGCTGCTGGGGAGG - Intronic
916518913 1:165545687-165545709 CACAGGGGCCGTGGCAGGCCGGG - Intronic
917788798 1:178486744-178486766 CCGAGAGGCCGCAGCAGGGCTGG + Intergenic
917962346 1:180154981-180155003 CCGCGGGGCCGCGTTAGCGCCGG - Exonic
919826481 1:201506969-201506991 CCCCGGGGCTGCGGCGGGGCTGG + Intronic
920528499 1:206685305-206685327 GCCGGGGGGTGCGGCAGGGCAGG - Exonic
920575070 1:207053324-207053346 CGCCGGGGCCAAGGCAGGGAGGG + Exonic
922234444 1:223712626-223712648 CGCCGGGACCGCAGCATGGCGGG + Exonic
922783318 1:228269978-228270000 CCCCCCGGCCGCGGCCGCGCCGG + Intronic
924436858 1:244049403-244049425 CCCCGGAGCCGCGGCCGTCCCGG - Intronic
924502801 1:244652995-244653017 CCCCGGGGGCGGGGCCGGCCCGG - Exonic
924624048 1:245685663-245685685 CCCCGGGTCTTCTGCAGGGCTGG - Exonic
1062774749 10:135635-135657 CCCAGAGGCCGCGGCCAGGCAGG - Intronic
1062989968 10:1806110-1806132 CCCGGGTGCTGCAGCAGGGCTGG - Intergenic
1063115603 10:3069193-3069215 TCCCGGGGGCGCTGCAGGGCGGG - Intronic
1063639910 10:7818939-7818961 CCCCGGGGACGCGGAGGGACAGG - Intronic
1063661196 10:8036021-8036043 CCCCGGGGGCGCGGAAGGTGCGG + Intergenic
1064059998 10:12129533-12129555 CACGGGCGCCGGGGCAGGGCGGG - Intergenic
1064060026 10:12129595-12129617 CCCTGGGGGCGGGGCTGGGCCGG + Intergenic
1064230741 10:13528338-13528360 CCCCGGTGCCTCCGCCGGGCTGG - Intronic
1064231015 10:13529131-13529153 CCCGGGGGCCGCCGCCGGCCTGG + Intergenic
1064354356 10:14604152-14604174 CCCCGGAGCCGGGGTCGGGCAGG + Intronic
1064478732 10:15719442-15719464 CCCCGGGCAGGCGGCAGGACGGG + Intronic
1065024310 10:21526347-21526369 CCGCGACGCCGCGGAAGGGCTGG - Intergenic
1066023081 10:31320829-31320851 CCCGGGGGCGGCGGGAGCGCAGG + Intronic
1066063974 10:31749411-31749433 CCCCGGGGCCGTGCCAGGCCAGG + Intergenic
1066464519 10:35640834-35640856 CACCGCGGCGGCGGCAGGGGCGG - Exonic
1067474453 10:46556684-46556706 CACCGGGGCGGCGGGAGGGGCGG + Intergenic
1068910561 10:62374539-62374561 CCCCGAGCCCGCAGCATGGCGGG + Intronic
1069654338 10:70076780-70076802 CCTCTGGGCTGTGGCAGGGCTGG + Intronic
1069709384 10:70479038-70479060 CCCCGGAGCCGCGGGCTGGCAGG + Exonic
1069761834 10:70816321-70816343 GCGCGGGGCCGCGGTGGGGCGGG + Intronic
1069769350 10:70887921-70887943 CCCCGGGGCGGGGGCGGGGGCGG - Intronic
1069873615 10:71548127-71548149 CACTGGGGCAGCGGGAGGGCTGG + Intronic
1069919879 10:71810092-71810114 ACCCGGGGCCGGGGCAGTGGAGG + Intronic
1069949123 10:72007407-72007429 CGCCGGGGCCCCGCCACGGCCGG - Exonic
1069994884 10:72336031-72336053 GCCCGGGGCTTGGGCAGGGCTGG + Intronic
1070198104 10:74177195-74177217 CCCCGGGGGCGGCCCAGGGCCGG + Intronic
1070954350 10:80454508-80454530 CCGCGGGGCCGCTCCTGGGCAGG - Intronic
1071309369 10:84328532-84328554 GCACGGGCCCGCGGCGGGGCGGG + Intergenic
1071515026 10:86291491-86291513 CCCCTGGGCTGAGGCAGGGCTGG - Intronic
1071784111 10:88880211-88880233 CCCAGGGGCCGGGGCAGGGGAGG + Exonic
1072420953 10:95290533-95290555 CCCCGGAAGCGCGGCGGGGCGGG - Intronic
1074130421 10:110568259-110568281 CCCCAGGGCCGCCCCCGGGCCGG - Intronic
1074830069 10:117241598-117241620 CCCCCAGGCCGCGGAAGGGCGGG - Intronic
1074854374 10:117462459-117462481 CCCTGGGGCTGCAGCAGGCCTGG + Intergenic
1074951545 10:118342094-118342116 GCCCGGGGCCGCGGAAGCGACGG - Intronic
1075246086 10:120823279-120823301 CCCAGAGGCCTCTGCAGGGCTGG - Intergenic
1075375421 10:121974805-121974827 CCCCGCGCCCGGCGCAGGGCGGG + Intronic
1075430296 10:122374764-122374786 AGCCGGGGCCGCGGCGGCGCGGG + Exonic
1075633681 10:124016292-124016314 TCCCAGGGCTGTGGCAGGGCTGG + Intronic
1075659319 10:124182396-124182418 CCCAGGGACAGCAGCAGGGCAGG + Intergenic
1075699761 10:124461795-124461817 CGCCGGCGCCGCGGCCGCGCAGG - Intergenic
1075713005 10:124540734-124540756 TCCCGGGGCCTCTGTAGGGCCGG - Intronic
1075769033 10:124917470-124917492 CCCGGGGGCTGTGGGAGGGCGGG + Intergenic
1075992203 10:126847760-126847782 CCTGGGGGGCGCGGCAGGGGTGG + Intergenic
1076612801 10:131737001-131737023 CCCCCGAGCCTCGGGAGGGCAGG - Intergenic
1076916328 10:133424515-133424537 CCCTGAGGCCGCGGCCGAGCGGG + Exonic
1076936435 10:133569310-133569332 CCCTGAGGCCGCGGCCGAGCGGG + Intronic
1077093953 11:791580-791602 CCCCCGGGCCTGGGCCGGGCAGG - Exonic
1077147746 11:1053501-1053523 ACCTGGGGCCGGGCCAGGGCAGG + Intergenic
1077153741 11:1082514-1082536 CACAGGTGCCGGGGCAGGGCAGG - Intergenic
1077173435 11:1178427-1178449 TCCCGGTGCCTCTGCAGGGCAGG + Intronic
1077390439 11:2298550-2298572 CCCCCGGGCCTGGGCAGGACTGG - Intronic
1077505774 11:2929476-2929498 CCCGAGGGCCGGGGCGGGGCGGG - Intergenic
1077677770 11:4212208-4212230 CTGCGGGGCTGCGGCAGGGAGGG + Intergenic
1077922974 11:6655484-6655506 CCCCTGGGCTGCGGCAGCGGCGG - Intronic
1079122514 11:17695906-17695928 GGCCGGGGCCGGGGCCGGGCCGG + Intergenic
1081549091 11:44095865-44095887 CTCCAGGGCGGCGGCCGGGCGGG + Intronic
1081763836 11:45595451-45595473 CCCTGGGTCTGGGGCAGGGCAGG - Intergenic
1081812638 11:45922389-45922411 CCCCAGAGCGGGGGCAGGGCAGG + Intronic
1081814039 11:45928807-45928829 CTCTGGGGCTGCTGCAGGGCTGG - Exonic
1082985970 11:59171909-59171931 TCCCGGGGCCGTGTCATGGCGGG + Intronic
1083033499 11:59615517-59615539 CTCCGGGGCCGCGTCAGGGACGG - Exonic
1083188881 11:61035417-61035439 CCCCGGGGCCTAGGCTGGGCTGG + Intergenic
1083303798 11:61752674-61752696 GCCCGGGGGCGCGGCATCGCCGG - Exonic
1083457168 11:62786931-62786953 CCCCGGGGCAGCGGCGGAGGCGG + Exonic
1083747768 11:64745004-64745026 CCCGGGCGGCGCGGCAGGGGAGG - Intronic
1083869370 11:65477499-65477521 CCCCGGCGCGGGGGCAGGGGAGG + Intergenic
1084070068 11:66728165-66728187 GCGCGGAGCCGCGGCCGGGCGGG + Intronic
1084180487 11:67443385-67443407 CCCGGTGAGCGCGGCAGGGCCGG - Exonic
1084190059 11:67494705-67494727 CCCCAGGGGCGGGGCAGGACTGG + Intronic
1084357464 11:68649835-68649857 CCCCGGGGCCGGGAAAGGGCCGG + Intergenic
1084385442 11:68840878-68840900 CGGCGGGGCCGCGGGAGGGTGGG - Intronic
1084385804 11:68841978-68842000 GCCCGGGGCCTCGGCGGGGCGGG + Intronic
1084421919 11:69064497-69064519 CCCCGGGGCAGCCGCAGAGGAGG - Intronic
1085010763 11:73140817-73140839 CCCTGGGGCCCCGGCCTGGCGGG - Intronic
1085044006 11:73343093-73343115 CGCCGGGGTGGCGGCGGGGCGGG - Intronic
1085346104 11:75768961-75768983 CCGCGGGGCCGTGACTGGGCGGG + Exonic
1088797230 11:113274174-113274196 CCCCAGGCCCGTGGCAGGGGAGG + Intronic
1089140121 11:116277893-116277915 CACAGGGGCTGTGGCAGGGCTGG + Intergenic
1089346658 11:117795784-117795806 CCCTGGAGCACCGGCAGGGCAGG + Intronic
1089457721 11:118635065-118635087 CCGCGGGGCCGGGGGAGGGGGGG - Intronic
1089520099 11:119057418-119057440 CCCCGGGGCCGGCGCTGGGGAGG - Intergenic
1089533899 11:119149332-119149354 CCCCCGGGCCGGTGCGGGGCCGG - Exonic
1090788517 11:130070152-130070174 AGCGGGGTCCGCGGCAGGGCGGG + Intronic
1091097931 11:132841424-132841446 CCCCTGGGCCTTGGCAGGCCTGG - Intronic
1091106017 11:132920585-132920607 CCCAGGGGCCGCGGCTGTCCTGG - Intronic
1091274734 11:134342554-134342576 CCCCGCGGCAGGGGAAGGGCAGG - Intronic
1091286766 11:134412296-134412318 CCCCGAGCCCGCGCCAGCGCCGG + Intergenic
1091588915 12:1831536-1831558 CCCTCGGGCCCCAGCAGGGCCGG - Intronic
1091730388 12:2876657-2876679 GCCCGCGGCCTCGGGAGGGCTGG - Intronic
1091746980 12:2998987-2999009 CCCGGGGGCCGAGCCAAGGCAGG + Intronic
1092258088 12:6937769-6937791 CGCCGGGGCCGCGGCGCTGCGGG + Intronic
1094155407 12:27332990-27333012 CGCCTGGGCCGGGGCAGGGCGGG + Intronic
1094375420 12:29783801-29783823 CGCCGGGGCCCCGGTAGGGGAGG - Exonic
1095976113 12:47942156-47942178 CCCCGTGGCCCCTGCAGGTCAGG - Intronic
1096101236 12:48971609-48971631 CCCGGCGGCCGCGGCGGCGCTGG - Exonic
1096105962 12:48997291-48997313 CCCCGCGGCCCCCGCCGGGCTGG + Exonic
1096127701 12:49131550-49131572 CCCCGCGGCCGCGCGAGGGGAGG - Intergenic
1096134591 12:49188801-49188823 CCCCGCCGCCGCCGCAGTGCGGG - Intronic
1096427582 12:51517146-51517168 CCACGGGGCCTCTGCAGAGCTGG + Intergenic
1096435874 12:51591009-51591031 CCGCGGGGGCGCGGGCGGGCGGG + Intronic
1096580284 12:52580714-52580736 CCCCAGGGACGGTGCAGGGCTGG - Intergenic
1096622658 12:52874243-52874265 CCCGCGGGGCGCGGCGGGGCGGG + Intergenic
1096682866 12:53268496-53268518 GCCCCGGGCCGCTGAAGGGCTGG + Intronic
1096791393 12:54047350-54047372 CCGCGGGGCCGCTGCAGAGCCGG + Intronic
1096796757 12:54082596-54082618 GGCCGGGGCCGGGGCCGGGCTGG + Intergenic
1096896121 12:54821903-54821925 CCCCGGAGCCAGGCCAGGGCTGG - Intergenic
1096981205 12:55728981-55729003 CCCCGGAGCCGCGGCGGGAGAGG - Intronic
1098420350 12:70290175-70290197 CCCCAGGGCCCAGACAGGGCTGG - Intronic
1100444817 12:94650581-94650603 CCCCGCGGCGGCGGCGGCGCAGG - Intergenic
1101131968 12:101698402-101698424 CCCCACGGCCGCGGACGGGCCGG + Intronic
1101340915 12:103841282-103841304 CCCCGCAGCGGCGGGAGGGCAGG - Intergenic
1102247181 12:111362898-111362920 CGGCGGGGCAGGGGCAGGGCTGG + Exonic
1102256426 12:111418195-111418217 CCGCGGGGCCGCCGCCGGGGAGG - Exonic
1103074206 12:117969093-117969115 CGCCGGGGCCGGGGCCCGGCTGG - Intergenic
1103294794 12:119877105-119877127 CCCCAGGGCTGCGGGAGGCCTGG - Intronic
1103360680 12:120351622-120351644 CCCTGGGCACGGGGCAGGGCTGG + Intronic
1103575368 12:121873416-121873438 CTCCAGGGCCCCGGTAGGGCTGG + Intergenic
1103595457 12:122022286-122022308 CCCGGGGCCCGCGGCGGGGCTGG - Intronic
1103749770 12:123150839-123150861 CCCCGCGGCCCCGGCCCGGCCGG + Intergenic
1103807562 12:123584958-123584980 CGCCGTGGCCGGGGCGGGGCGGG - Intronic
1104796862 12:131526219-131526241 CCCCTGGGCCCCTGTAGGGCTGG + Intergenic
1104866964 12:131961475-131961497 CCCAGGGGCCGGGGCAGCGGCGG - Exonic
1104885513 12:132104843-132104865 CCCAGGGGCCGGGGCAGCGGCGG - Exonic
1104983414 12:132583672-132583694 CCCCCGGGCCGCCGCGGAGCCGG + Exonic
1105071429 12:133236190-133236212 CCTCGGCTCCGCTGCAGGGCGGG - Intergenic
1107976122 13:45690406-45690428 CCTTGGGTCCGCAGCAGGGCAGG - Intergenic
1112077717 13:95931526-95931548 CCACGGTGCCGGGGCAGGGTGGG + Intronic
1113379219 13:109787022-109787044 GGGCGGGGCCGCGGCTGGGCGGG + Intergenic
1113746521 13:112749060-112749082 CCCTGGGGCCCCAGCAGAGCTGG - Intronic
1113768300 13:112894247-112894269 CCCGGGGGCGGGGGCGGGGCGGG - Intergenic
1113936177 13:113996257-113996279 CCCCGGGGGAGCGGGAGGTCAGG - Intronic
1114265371 14:21070227-21070249 CCGCGGGGCCCCGCCAGGGAGGG - Intronic
1114633274 14:24172945-24172967 AAGCGGGGCCGCGGCAGGCCGGG - Exonic
1114637440 14:24195761-24195783 CCCAGGGGCCGCAGCAGCGAAGG - Intronic
1115752336 14:36505507-36505529 CGGCGGAGCCGCGGCTGGGCGGG + Intronic
1117315092 14:54565947-54565969 CCCCGGACCCGGCGCAGGGCGGG - Intergenic
1117424551 14:55580613-55580635 CCCGGGTGCCGCGACAGAGCCGG - Intronic
1119716973 14:76866588-76866610 TCCCGGGGCCCAGGCAGGGACGG + Intronic
1119786886 14:77320817-77320839 CCCCGGGCTCGGGGCGGGGCGGG + Exonic
1121253011 14:92513636-92513658 CCCCGGGGGCGCGGCCGCCCGGG + Intergenic
1121274505 14:92658343-92658365 CCCCGGGGCAGGAGCAGGCCTGG + Intronic
1121358197 14:93232312-93232334 CCTCGGGGCGCCTGCAGGGCAGG - Intergenic
1122255347 14:100472204-100472226 CCCTGGAGCCCCGGCTGGGCAGG + Intronic
1122310673 14:100792231-100792253 ACCCAGGGCTGAGGCAGGGCAGG - Intergenic
1122418133 14:101560154-101560176 CTCGGACGCCGCGGCAGGGCCGG + Intergenic
1122418375 14:101560981-101561003 CCCAGGTGCCGCGGGAGGCCGGG - Intergenic
1122705319 14:103617169-103617191 CCCCAGGGTCCCGGCAGGGAGGG - Intronic
1122961121 14:105093973-105093995 CCCCAGGTTCCCGGCAGGGCGGG + Intergenic
1122987140 14:105217667-105217689 CTCCGGGGCCTCAGCAGCGCCGG - Exonic
1123019236 14:105389846-105389868 CCCTGGGGCCGCGGCCCTGCCGG - Intronic
1123037990 14:105479075-105479097 CCCCGGGGCGGGGGCGGGGGCGG - Intronic
1123710007 15:22980241-22980263 CCCCGCGGAGGCCGCAGGGCAGG + Intronic
1123710074 15:22980450-22980472 GGCCGGGGCCGCGGCCGGGAGGG - Intronic
1124351863 15:28961629-28961651 TCCCGGGGGAGCGGCCGGGCGGG + Intronic
1124371112 15:29105294-29105316 GCAGGGGGCTGCGGCAGGGCTGG - Intronic
1124497729 15:30196430-30196452 TCCGGGGACCGCGACAGGGCGGG + Intergenic
1124670458 15:31634203-31634225 CCCTGGAGCCCCGTCAGGGCAGG + Intronic
1124743132 15:32315373-32315395 CCTCGGGGCCGCGCCGGGGCCGG - Intergenic
1124745857 15:32342261-32342283 TCCGGGGACCGCGACAGGGCGGG - Intergenic
1124783727 15:32659638-32659660 CCCCTGGGCTTCTGCAGGGCAGG - Intronic
1125535894 15:40441119-40441141 CCTGGGGGCCGGGGCCGGGCGGG - Intronic
1125664132 15:41417024-41417046 CGTCGGGGGCGGGGCAGGGCGGG + Intronic
1125914565 15:43474137-43474159 GCCCGGGGGGCCGGCAGGGCCGG + Intronic
1126738038 15:51751566-51751588 CCCCGGCGCCGCGCCCGGCCGGG + Exonic
1127922673 15:63505139-63505161 GCCCCCGGCCACGGCAGGGCGGG - Intronic
1128078318 15:64841828-64841850 TCCGGGGGCCGGGGCGGGGCCGG - Intergenic
1129162113 15:73752850-73752872 GCCGGGGGCCCCGGCCGGGCTGG + Intergenic
1129162219 15:73753160-73753182 CCCCGGGAGCCCGGCGGGGCAGG - Intergenic
1129194529 15:73956063-73956085 CCCTGGGCCCTTGGCAGGGCGGG + Intergenic
1129466658 15:75728030-75728052 CCCCGAGACAGGGGCAGGGCAGG + Intergenic
1129483337 15:75844180-75844202 TCCCGGGACCGGGGCGGGGCGGG + Intronic
1129710653 15:77818972-77818994 CCCCTGGGGCGCGGCGGGCCGGG - Intronic
1129933691 15:79432179-79432201 TCCCGGGGCCGCTGGAGCGCGGG + Intergenic
1130353084 15:83108060-83108082 CCCCTGGGCCCCTCCAGGGCAGG - Intronic
1131526745 15:93158772-93158794 TCCCAGGGCTGGGGCAGGGCGGG + Intergenic
1132111466 15:99105091-99105113 CTCCGGGGCAGCGGCGAGGCCGG + Exonic
1132186757 15:99807163-99807185 TCCCGGGACCGCGACGGGGCGGG + Intergenic
1132334968 15:101042458-101042480 CCCCTGGGCTGCAGCAGAGCAGG - Intronic
1132357090 15:101179774-101179796 CCACGGGGCGGAGGCAGGGTTGG - Intronic
1132428930 15:101745548-101745570 TCCCGGGACCGCGACGGGGCGGG - Intronic
1132537815 16:492079-492101 CCCTGGGGCAGGGACAGGGCAGG - Intronic
1132556878 16:576420-576442 CGCTGGGGCCTGGGCAGGGCAGG + Intronic
1132585996 16:705959-705981 CGCGGGGGCCGGGGCGGGGCGGG - Intronic
1132621178 16:868913-868935 CCCCTGAGCAGCGGCAGGGAGGG + Intronic
1132689808 16:1177415-1177437 CTCCGGGGCGACGGCAGGGTGGG - Intronic
1132703734 16:1232310-1232332 CCCTGGGGCTGCTGCAGGGCTGG + Intergenic
1132704776 16:1239051-1239073 CCCTGGGGCTGCTGCAGGGCTGG - Intergenic
1132707784 16:1254085-1254107 CCCTGGGGCTGCTGCAGGGCTGG - Intergenic
1132779359 16:1614322-1614344 GGCCGGGGCCGGGGCCGGGCAGG + Intronic
1132806864 16:1778950-1778972 CCTGGGGGCCCCTGCAGGGCTGG - Intronic
1132858390 16:2057790-2057812 TGCAGGGGCCGAGGCAGGGCTGG - Intronic
1132858399 16:2057819-2057841 TGCAGGGGCCGAGGCAGGGCTGG - Intronic
1132858408 16:2057848-2057870 TGCAGGGGCCGAGGCAGGGCTGG - Intronic
1132858417 16:2057877-2057899 TGCAGGGGCCGAGGCAGGGCTGG - Intronic
1132858426 16:2057906-2057928 TGCAGGGGCCGAGGCAGGGCTGG - Intronic
1132858435 16:2057935-2057957 TGCAGGGGCCGAGGCAGGGCTGG - Intronic
1132858444 16:2057964-2057986 TGCAGGGGCCGAGGCAGGGCTGG - Intronic
1132858453 16:2057993-2058015 TGCAGGGGCCGAGGCAGGGCTGG - Intronic
1132942160 16:2513770-2513792 CGCGGAGGCCGAGGCAGGGCGGG + Intronic
1133023092 16:2975442-2975464 CCCCGGGGCCGCTGCAAGCTGGG - Exonic
1133213100 16:4273774-4273796 GCCGGGGGCCCCGGCAGGGAGGG + Intergenic
1133232390 16:4372798-4372820 CCCCTGGGCCACAGCAGGGGAGG - Intronic
1134018795 16:10907451-10907473 CCCCGGGGCCCTGGCAGAGCTGG + Exonic
1134441552 16:14302175-14302197 GCCCGGGGCGGGGGCTGGGCCGG - Intergenic
1135417591 16:22280396-22280418 CCCCTGGGCTGCAACAGGGCTGG + Intronic
1135607364 16:23836117-23836139 CCCCGGGGCCGCGGGACCGCGGG - Exonic
1136261809 16:29082336-29082358 ACTCGGGGCCGCGGCGGGCCGGG + Intergenic
1136519452 16:30786700-30786722 CCCGGGGGCCGGGGCAGGGGCGG - Intronic
1136554104 16:30997656-30997678 CCCCGCGGCAGCGCCAGGCCCGG + Intronic
1136909898 16:34136376-34136398 CCCAAGTGCCGCGGCAGGTCGGG + Intergenic
1137665381 16:50246329-50246351 CCGCGAGGCCGGGGAAGGGCGGG - Intronic
1137988760 16:53131404-53131426 TCCCGGGGCCGGGGTCGGGCGGG + Intronic
1138543453 16:57702263-57702285 CTCCAGGGCAGCGGAAGGGCTGG - Intronic
1139364862 16:66427117-66427139 GGGCGGGGCTGCGGCAGGGCAGG + Intergenic
1139390761 16:66605255-66605277 CCCCGGGGCCCAGAGAGGGCGGG - Intronic
1139489593 16:67279298-67279320 GCCCGGGGGTGCGGCGGGGCGGG + Exonic
1141564490 16:84892130-84892152 CCCTGGGGTGGTGGCAGGGCAGG + Intronic
1141693979 16:85611496-85611518 CCCCCGCGCCGTGCCAGGGCCGG + Intronic
1141840127 16:86568574-86568596 GCCCGGGGCCGCCGCGGCGCAGG + Exonic
1141957538 16:87383079-87383101 CCACGGGGCCGAGGCCGTGCCGG - Intronic
1141989493 16:87602274-87602296 CCCCGGGGCCCCCGCCGGACTGG - Intronic
1142012457 16:87722801-87722823 CCCCGGGGAGGCGCCAGGTCTGG + Intronic
1142130003 16:88428090-88428112 CCCCGGGGCCCCCCCAGAGCAGG + Exonic
1142211727 16:88811682-88811704 CGCCGGGGCCGAAGGAGGGCAGG + Intronic
1142271865 16:89094013-89094035 CCACGGGACCGCGGCGGGGTCGG + Intronic
1142349887 16:89575195-89575217 CCCCGAGGCCGGGGCGGGGCGGG - Intergenic
1142377147 16:89712007-89712029 CCCTGGGGCCGCTGCGGGGAGGG - Intronic
1142406168 16:89891408-89891430 GCCCGGGGCCAGGGCAGGGATGG + Intronic
1142594626 17:1023458-1023480 GCCCTGGGCTGGGGCAGGGCCGG - Intronic
1142611065 17:1109388-1109410 CCCCGGAGCCCGGGAAGGGCGGG - Intronic
1142757325 17:2024036-2024058 CCCCCGGGCCCTGGGAGGGCAGG - Intronic
1143078492 17:4365476-4365498 GCCCGGGGCGGCGGCCGGGTCGG - Intronic
1143121076 17:4607290-4607312 CCCCACAGCCGCGACAGGGCCGG - Intronic
1143497858 17:7322717-7322739 CCCAGGTGCGGCAGCAGGGCGGG - Exonic
1143830294 17:9645644-9645666 CCCCGGGGACGCGGCAGGAGGGG + Exonic
1144658500 17:17053096-17053118 CCTCAGGGCCGCGGGAGGGGTGG + Intronic
1144840739 17:18184150-18184172 CCCCGGGGCCCCCGGAGGGAGGG - Intronic
1145077509 17:19867855-19867877 GCGCGGGGCCGCGGCGGTGCGGG - Exonic
1145765508 17:27456259-27456281 CCCGGCGGCCGCGGCGAGGCAGG - Intergenic
1145836814 17:27960600-27960622 CCCAGGGGCATCGGCAGGACTGG + Intergenic
1145937917 17:28726057-28726079 CCCAGGAGCAGCGGCAGGGCGGG + Exonic
1146008434 17:29176886-29176908 CCGCGGGGCTGCGGCTGCGCCGG - Intronic
1146343233 17:32040314-32040336 CCCCGGGGCAGGCGCAGAGCTGG + Intronic
1146398727 17:32487523-32487545 CTCCGGGGCCGCCGCAGGCTCGG + Exonic
1147044739 17:37744274-37744296 CCGCGGGGCTGGGGCTGGGCCGG - Intronic
1147792410 17:43021845-43021867 CGCCGGGGGTGTGGCAGGGCGGG - Intronic
1147966943 17:44199088-44199110 CGCCGGGGCCGGCGCCGGGCCGG + Intronic
1147967012 17:44199271-44199293 CCCCTTGGGCGGGGCAGGGCCGG - Intronic
1148048786 17:44759290-44759312 TCCCGGGGCGGGGGCAGGGAGGG - Intronic
1148167036 17:45490792-45490814 ACCGCGGGCCGGGGCAGGGCCGG - Intergenic
1149993987 17:61397370-61397392 CCCCGGGGCTCCGCCAGGGGAGG + Intergenic
1150398212 17:64837196-64837218 CCGCGGGCCGGGGGCAGGGCCGG - Intergenic
1150488790 17:65560928-65560950 CCCCGACGCCGCGGCCGGCCCGG - Intronic
1150643592 17:66965067-66965089 CGCCGCGGGCGCGGCGGGGCGGG - Exonic
1151662329 17:75525543-75525565 TCCCGGGGCCGCGGATTGGCAGG + Intronic
1151802142 17:76384854-76384876 TCCCGGGGCCCCGCGAGGGCGGG - Exonic
1152245615 17:79183230-79183252 GCCGGGGGCCGGGGCCGGGCGGG + Intronic
1152357075 17:79812672-79812694 GCCCGGGGGCGCACCAGGGCAGG - Intergenic
1152375481 17:79916718-79916740 CCCAGGGGCGGCGGCAGGAGGGG - Intergenic
1152468050 17:80476704-80476726 GCCCGGGCCCGCGGCGCGGCGGG + Intronic
1152631408 17:81412177-81412199 ACCAGGGCCCACGGCAGGGCTGG - Intronic
1152642720 17:81455892-81455914 CTCCGTGGCCTCGGCGGGGCTGG + Intronic
1152714377 17:81891462-81891484 GGCCGGGGCCGCGGCCGGGCCGG - Exonic
1152781993 17:82230757-82230779 CCCTGGGGCAGGGGCGGGGCGGG + Intronic
1152798781 17:82321656-82321678 CCCGGGGGCCGAGGTAGGGTCGG - Exonic
1152934667 17:83129027-83129049 GCCCGGGGCCGGGTCAGGCCAGG + Intergenic
1153226947 18:2906839-2906861 CCGCTGGGCCTCGGCGGGGCGGG - Exonic
1153280802 18:3412165-3412187 CCTCGGGATCGCGGCGGGGCCGG - Intronic
1153457223 18:5295270-5295292 GCCCCCGGCCGCGGGAGGGCGGG - Intronic
1153636649 18:7118121-7118143 CTGCAGGGCCGCGGCGGGGCGGG - Intergenic
1153805312 18:8705335-8705357 CACCGGTGCCGCGGCGGCGCTGG - Intergenic
1154991227 18:21600231-21600253 CACCGGGGCAGCGCCAGTGCTGG - Intronic
1155199982 18:23508700-23508722 ACACGGGGCCACTGCAGGGCAGG - Intronic
1156449643 18:37259643-37259665 CCCCAGAGCAGGGGCAGGGCAGG - Intronic
1156467320 18:37356024-37356046 CCCTGGGGCCAGGCCAGGGCTGG - Intronic
1157222182 18:45836401-45836423 CCCTGGGGCACCGGCTGGGCAGG + Intronic
1157513441 18:48294764-48294786 CCCCAGGGCTGTGGCAGGGAAGG + Intronic
1158579910 18:58671857-58671879 GCTCAGGGCCGCGGCAGGCCGGG + Intronic
1158836104 18:61333535-61333557 CGCGGTGGCCGCGGGAGGGCAGG + Intergenic
1158954160 18:62523599-62523621 CCCCGGGGCGGCGGCGGCGGCGG - Exonic
1159040669 18:63320356-63320378 GCGCGGGGCCGCGGCCGGGGAGG + Intergenic
1160025554 18:75212174-75212196 GCCGGGGGCCGCGGGACGGCGGG + Intronic
1160040009 18:75336957-75336979 CCCTGGGGCCGGGCCAGGCCTGG + Intergenic
1160236920 18:77093177-77093199 ACCCGGGGTCGAGGCTGGGCCGG + Intronic
1160392182 18:78542387-78542409 CCCAAGAGCCGCGGGAGGGCAGG + Intergenic
1160540481 18:79617678-79617700 GCCCGGGGCCGCAGCATGGGGGG + Intergenic
1160769984 19:826481-826503 GCCAGGGGCCGGGGGAGGGCAGG - Intronic
1160873069 19:1285805-1285827 CCGCGCGGCCGGGGCACGGCGGG + Intergenic
1160895787 19:1401263-1401285 CCCCGGGGGCGGTGCAGGCCGGG + Intronic
1160901835 19:1432702-1432724 CAGCGGGGACGCGGCATGGCAGG - Intronic
1160921832 19:1524261-1524283 CCCCGAGTCCGCGACGGGGCCGG + Intronic
1160930295 19:1567111-1567133 GCCCGGGGCTCCGGCCGGGCGGG - Intronic
1160949327 19:1658030-1658052 CCCCGAGGCGGGGGCAGGGCAGG + Intergenic
1160992276 19:1864621-1864643 CCCCGGTGTCCCAGCAGGGCGGG - Intergenic
1161063705 19:2227536-2227558 CCCTGGGGCTGCTGCGGGGCGGG + Intronic
1161089150 19:2351682-2351704 CCCCGTCGCGGCCGCAGGGCTGG - Intronic
1161101817 19:2425276-2425298 GCCCGGGGCCGCGGTGGTGCGGG + Intronic
1161118816 19:2513778-2513800 CTGGGGAGCCGCGGCAGGGCGGG - Exonic
1161153756 19:2721908-2721930 CCCAGGGGCCTGGGCAGGGGCGG + Intronic
1161284937 19:3464030-3464052 CCCCCGCGCCCCGGCAGGGCAGG - Intronic
1161326807 19:3668039-3668061 CCCAGGAGCCAGGGCAGGGCTGG - Intronic
1161327275 19:3669958-3669980 CCTCGGGGCAGGGGCAGGCCGGG + Intronic
1161395750 19:4044087-4044109 CCCCGGGGCCGTGGCAGGAGCGG - Intergenic
1161471146 19:4457365-4457387 ACCCGGGGGCGCGGCGGGGGAGG - Intronic
1161495839 19:4585072-4585094 CCCCGGGGCTGGGGGAGTGCTGG + Intergenic
1161505076 19:4639503-4639525 GGCCGGGGCCGGGGCGGGGCGGG - Intronic
1161618857 19:5287680-5287702 CCCTGGGACCGCCCCAGGGCTGG - Intronic
1161628774 19:5340895-5340917 CGCCGGGTCGGGGGCAGGGCCGG + Intergenic
1161776251 19:6263820-6263842 CCATGGGGGCGCCGCAGGGCAGG + Intronic
1161958471 19:7509240-7509262 CCCTGGGGCCGGGGAAGGGTGGG + Intronic
1162398344 19:10430749-10430771 CCGCGGGCCCGGGGCTGGGCAGG + Intronic
1162426904 19:10602514-10602536 CTCCATGGCCGCGGCGGGGCGGG - Intronic
1162471002 19:10871935-10871957 CCCCGGGGCAGGCGCAGGGCCGG + Intronic
1162968495 19:14166838-14166860 GCCCGTGGCCGCACCAGGGCTGG + Intronic
1163117900 19:15199747-15199769 CCCCGGGGCCCGGACGGGGCAGG - Intronic
1163138648 19:15331963-15331985 CGCGGGCGCCGCGGCGGGGCCGG - Intronic
1163158041 19:15449683-15449705 CCCCGGGGCGGGGGCGGGGGCGG - Intronic
1163282333 19:16325383-16325405 CCGCGGGGGCGCTGTAGGGCGGG - Exonic
1163523773 19:17807968-17807990 GCACGGGGCCGGGGCTGGGCGGG - Exonic
1163554687 19:17985223-17985245 CCCTGGGGCAGCGCCAGGGCTGG - Intronic
1163655576 19:18543309-18543331 CCGAGGGGGCGCGGCCGGGCGGG - Intronic
1163666680 19:18606854-18606876 CCCCGGGGCCGGGCCGGGCCGGG - Intronic
1163725180 19:18919306-18919328 CCCCGGAGCCGCCGGAGGCCGGG + Exonic
1164137743 19:22428655-22428677 GCTGGGGGCCCCGGCAGGGCGGG + Intronic
1164595823 19:29530166-29530188 CCCCGAGGCCGCGGCAGCCTCGG + Exonic
1165273667 19:34731480-34731502 CCCTGGGGCTGAGACAGGGCTGG - Intergenic
1165305480 19:35000435-35000457 CCCCGGGCGCAGGGCAGGGCAGG - Exonic
1165772594 19:38387797-38387819 CCCTGGGCCCGGGGCAGGGCAGG + Exonic
1166129955 19:40740180-40740202 CCACAGGGCCACAGCAGGGCAGG - Exonic
1166366385 19:42280555-42280577 GCCCGAGGACGCGGCAGCGCAGG - Intronic
1166547048 19:43639899-43639921 CGCCGAGGCCGGGGCGGGGCCGG + Intergenic
1166785587 19:45364865-45364887 CCCTGGGGCGGCGCCAGGGCTGG - Exonic
1166854642 19:45777492-45777514 CCCCGGAGACACGGCTGGGCCGG - Exonic
1166869822 19:45864413-45864435 CCCCGGGGCCGGAGCGGGGGCGG + Exonic
1167001107 19:46746250-46746272 CCCCGGGCCCACGGCGGGCCCGG - Exonic
1167145967 19:47680987-47681009 CCCGGTGGCAGCGGCAGGGGTGG - Exonic
1167250066 19:48394800-48394822 CCCCGGGGCGGCGGCAGTGGTGG - Intergenic
1167270002 19:48501245-48501267 CGCGGGGGCCGAGGCAGGCCAGG - Intronic
1167411591 19:49347312-49347334 CTCCGGGGCTGGGGCAGTGCTGG + Exonic
1167578484 19:50328924-50328946 CGCCGGGGACGCGGCGGGGCCGG + Exonic
1167641878 19:50686848-50686870 CCCCGGGGGCGGGGCGGAGCGGG + Intronic
1167679286 19:50909524-50909546 CCTCGGGGCGGAGTCAGGGCTGG + Intronic
1167738696 19:51311729-51311751 CCCCCGGGCCGGTGCAGCGCAGG + Intergenic
1167758656 19:51429221-51429243 CCCTGAGGCCTGGGCAGGGCAGG + Intergenic
1168056166 19:53866462-53866484 CCCCCGGGGAGGGGCAGGGCGGG - Intronic
1168267430 19:55230457-55230479 TCCCGGGGTGGGGGCAGGGCGGG - Exonic
1168267725 19:55231559-55231581 GCCCAGGGCCGCGGGTGGGCAGG + Intronic
1168687705 19:58358441-58358463 CCCCGCTGCCAAGGCAGGGCAGG + Intronic
1168721771 19:58558395-58558417 CCCCGCGGCGGCGGCAGCGGCGG - Exonic
1168722796 19:58563417-58563439 CCCTGGGACCTCGGCATGGCTGG - Exonic
925041900 2:738710-738732 CCTCAGGGCTGGGGCAGGGCAGG + Intergenic
925130145 2:1488763-1488785 GCCCAGGGACGGGGCAGGGCAGG - Intronic
925288303 2:2730149-2730171 GCCCGGGGCTGCAGCAGGGAGGG + Intergenic
925610403 2:5696858-5696880 CCCCGGGGCCGCCGCAACGAAGG + Exonic
925979275 2:9164087-9164109 CCCCGGGGCAGGGGCAGCACTGG + Intergenic
926012939 2:9423108-9423130 CCCCGGAGGGGCGGCAAGGCGGG - Exonic
926131240 2:10304176-10304198 CCTGGGGGCTGGGGCAGGGCCGG - Intronic
926718639 2:15942741-15942763 CCCCGGGGCCCCGGCTGGGGCGG - Exonic
927472505 2:23386168-23386190 GCCCAGGGCCCCGGCCGGGCAGG + Intronic
927964972 2:27262833-27262855 CCCCGGGACCGCGGTGGCGCCGG - Exonic
928025589 2:27736205-27736227 CCCTGGGGCTGAGGGAGGGCAGG - Intergenic
928186546 2:29115689-29115711 CCCCCGGGCCGCGGGCTGGCCGG + Intronic
929242508 2:39666462-39666484 GCGCGGGGCCGCGGCTGGGAGGG - Intronic
929452930 2:42048482-42048504 GGCCGGGGGCGCGGCAGGCCGGG - Exonic
930019458 2:46992604-46992626 CCCTGGGGCCACTGTAGGGCTGG + Intronic
930222103 2:48755527-48755549 CCGTGGGGCCGGGGCAGCGCAGG + Exonic
932430294 2:71670172-71670194 CCATGGGGTGGCGGCAGGGCTGG - Intronic
932765210 2:74464969-74464991 GTCCGGGGCCACGGCGGGGCTGG + Exonic
932773230 2:74513290-74513312 CCCGGGGGCCGGGGCGGGCCGGG + Intergenic
934705012 2:96471001-96471023 CCCAGGGGCCACGGCGGGGTTGG + Intergenic
935046718 2:99489785-99489807 CCCCGGGCCGGCGGCGGGGTGGG - Intronic
935746510 2:106194084-106194106 CCCCGGCGCCGCGGTGGGCCGGG - Intronic
935775239 2:106466779-106466801 CATCGAGGCCGCCGCAGGGCCGG + Intronic
935904388 2:107827415-107827437 CATCGCGGCCGCGGCCGGGCCGG - Intronic
936079734 2:109423994-109424016 CGTCTGGGCCGCTGCAGGGCCGG + Intronic
936433182 2:112482009-112482031 CCCGGGGGCGGCGGCGGCGCAGG - Intergenic
936561337 2:113541950-113541972 CCCGGGAGCCGCAGCAGGACCGG + Intergenic
936935588 2:117836063-117836085 GCCGGGAGCCGCGGAAGGGCCGG - Intergenic
936938211 2:117858683-117858705 CCCCCTGGCCGGGGCAGAGCGGG + Intergenic
937132572 2:119524361-119524383 CCCGGGGCCCGCCGCAGGTCGGG - Exonic
937951079 2:127388188-127388210 CCCCGGGGCAGGGGCGGGGGCGG - Intronic
941020956 2:160407624-160407646 GCCCGGGGCCGCGGCAGCTCTGG + Intronic
941096685 2:161245163-161245185 CCCCCCGGCCGCGGCCGCGCCGG + Intergenic
942116888 2:172736314-172736336 GCCTGGAGTCGCGGCAGGGCAGG - Intronic
945404004 2:209423787-209423809 GCCCGGGCCAGCGGCTGGGCGGG + Intergenic
946185498 2:217978563-217978585 CCCGGGGGCGGGGGCAGGGGCGG - Intronic
946233275 2:218306012-218306034 CCCCGGGGGCATGGTAGGGCTGG + Intronic
947399215 2:229714882-229714904 CCCCAAGGCCCGGGCAGGGCAGG + Intergenic
947418478 2:229921693-229921715 CGGCGGGGCCGCGGAAGGACCGG - Intronic
947866167 2:233399448-233399470 CCCAGCAGCCACGGCAGGGCTGG + Intronic
948192493 2:236070759-236070781 GCCCTGGGCCGGGGCAGGGGCGG + Intronic
948393334 2:237627566-237627588 GGCCGGGGCCGGGGCCGGGCCGG + Intronic
948645146 2:239400198-239400220 CCGGGGGGTCGCGGGAGGGCGGG - Intronic
948945024 2:241215075-241215097 CCACAGGGCAGCTGCAGGGCGGG - Intronic
949027795 2:241774530-241774552 CCTCGGGGCAGGGGCAGGGGTGG - Intergenic
1168869792 20:1118608-1118630 GCCCGGGGACGGGGCGGGGCGGG - Exonic
1169065624 20:2692959-2692981 GCCCGGGGCTACGGCAGGGCCGG + Exonic
1169367137 20:5001142-5001164 CCCCGGGGGCCCGGCCCGGCCGG + Intronic
1170578225 20:17680742-17680764 CCCCGCGCCCGCCGCAGTGCCGG + Intronic
1171173615 20:23035507-23035529 CCCCGGGGGCGAGGAAGGGCTGG + Exonic
1171361597 20:24590228-24590250 CCCCAGGGCCTCGGCACTGCAGG - Intronic
1172109560 20:32537048-32537070 CCGGGGGGGCGGGGCAGGGCAGG - Intronic
1172230572 20:33333148-33333170 CCACGTGGCCCTGGCAGGGCAGG + Intergenic
1172404389 20:34676897-34676919 CACAGAGGCCGCGGGAGGGCAGG + Intronic
1172841087 20:37903162-37903184 CCCCGAAGCCGGGGCTGGGCCGG + Exonic
1173166508 20:40690032-40690054 CCTCGGGGCCGAGGCCGGCCCGG + Intergenic
1173190191 20:40870061-40870083 CCCAGTGGCCCAGGCAGGGCAGG - Intergenic
1173279946 20:41618698-41618720 CCACGGGGGCGGGGCGGGGCCGG + Intergenic
1173454783 20:43193108-43193130 CGCTGGGGGCGAGGCAGGGCTGG - Intergenic
1174340576 20:49892618-49892640 CCCCGCTCCTGCGGCAGGGCAGG - Intergenic
1174357786 20:50009967-50009989 CGCCGGGGCCGCGGCCTGGAGGG - Intergenic
1175266967 20:57709216-57709238 CCCCGGGTCCGAGTCCGGGCGGG + Intronic
1175422052 20:58840780-58840802 CTCCGGGGACGCGTCACGGCGGG - Intronic
1175561310 20:59933282-59933304 CCCCGAGGCCGAGGCTGGCCAGG + Intronic
1175715734 20:61253166-61253188 CCCCGAGCCCTCGGCGGGGCTGG + Intronic
1175795376 20:61767393-61767415 CCCCGGGGCAGTAGCAGGTCCGG + Intronic
1175966526 20:62662675-62662697 CCCCGGAGCCTGGGCAGGTCTGG + Intronic
1176021231 20:62963392-62963414 CCTTGGAGCAGCGGCAGGGCCGG + Intronic
1176030680 20:63009784-63009806 GCCAGGGGCCGCTGCAGGGGCGG - Intergenic
1176077393 20:63254582-63254604 ACCCGGGGCTGGGGCTGGGCCGG - Intronic
1176169592 20:63690867-63690889 CCCCTGGGCCTCTGCCGGGCAGG - Exonic
1176207194 20:63895438-63895460 CCCCCGGGCCGGGGCTGCGCGGG + Intronic
1176221137 20:63969824-63969846 CAGCGGGGCTGCGGCCGGGCCGG + Intronic
1176301400 21:5100714-5100736 CCCAGGGGCTGGGCCAGGGCAGG + Intergenic
1178914467 21:36698990-36699012 CTCCAGGGCCGCGGCGGGGTCGG + Intergenic
1178992603 21:37367637-37367659 GGGCGGGGCCGCGGCCGGGCCGG - Intronic
1179714273 21:43279802-43279824 CCCCGGGGCAGCAGCAGGCTTGG + Intergenic
1179821322 21:43939045-43939067 CGCAGGGGCCGCACCAGGGCTGG + Intronic
1179855631 21:44161185-44161207 CCCAGGGGCTGGGCCAGGGCAGG - Intergenic
1179908703 21:44436988-44437010 CCCCTGCGCCGCGGCGGGGCTGG - Intronic
1180057501 21:45366560-45366582 CTCCGGGTCAGCGGCGGGGCGGG + Intergenic
1180064676 21:45406186-45406208 CCCCCGGGCCTCTGCTGGGCTGG - Intronic
1180161433 21:46000223-46000245 CCCTGGGGCCCCCACAGGGCGGG - Intronic
1180791610 22:18578066-18578088 CCTCGGGGGCGGGGCCGGGCCGG + Intergenic
1180866374 22:19122225-19122247 CCCCGGGGCGGCTGGAAGGCCGG + Exonic
1181026822 22:20131725-20131747 GCTGGGGGCCGCGGCGGGGCGGG - Intronic
1181695988 22:24593019-24593041 CCATGGGGGCGCGGCTGGGCCGG - Exonic
1182903853 22:33920446-33920468 CTCCGGCGCGGCGGCGGGGCAGG + Intronic
1183093954 22:35541205-35541227 CCCCCGGCTCGGGGCAGGGCAGG + Exonic
1183228146 22:36564285-36564307 CCCCGGGGGCGGGGCGGGGCGGG - Exonic
1183481755 22:38069134-38069156 CCCCGGGGCCCCAGCTGGGTGGG - Intronic
1183486228 22:38089060-38089082 CCCCGGGGCGGCAGGAGGGCCGG - Intronic
1183824040 22:40370879-40370901 GGCCGGGGACGCGGCGGGGCGGG + Intronic
1184017923 22:41800031-41800053 GCCCGGGGCCCCTGCCGGGCGGG - Intergenic
1184086832 22:42270464-42270486 GCCCGGGCCGGCGGCGGGGCGGG + Intronic
1184236947 22:43187506-43187528 CCCGGGGGCCGCGGCAAACCGGG - Intergenic
1184417432 22:44360451-44360473 ACCCGGGGCTGCAGCAGGGTGGG + Intergenic
1184439193 22:44498233-44498255 GGCCGGGGCCGGGGCAGGGGCGG + Exonic
1184449068 22:44572234-44572256 GCCCTGGGCTGCGGCAGTGCTGG - Intergenic
1184557354 22:45240608-45240630 ACCCGGGGGCGAGGCCGGGCCGG - Intronic
1184597737 22:45524447-45524469 CCCCAGAGCCCCGGCAGGGCTGG + Intronic
1184645218 22:45891575-45891597 CCCCTGGGCTGGCGCAGGGCAGG - Intergenic
1184766913 22:46576987-46577009 CCGCGGGGCGGGGGCGGGGCCGG + Intronic
1184785911 22:46671984-46672006 CCCTGGGGCCCCTGCAGGGAGGG + Intronic
1184820372 22:46905523-46905545 CCCGGGGCCGGCTGCAGGGCTGG - Intronic
1184821122 22:46909851-46909873 CCCTAGGGGCTCGGCAGGGCTGG + Intronic
1185068152 22:48642233-48642255 CCCTGGGGCTCTGGCAGGGCTGG - Intronic
1185104848 22:48861857-48861879 CCTCTGGGCTGTGGCAGGGCAGG - Intergenic
1185394991 22:50582396-50582418 GGCCGGGGCCGCGGCAGGTAGGG - Intronic
950400963 3:12768915-12768937 GGCCGGGGCCGGGGCGGGGCGGG + Intronic
950453853 3:13080767-13080789 CCCTGGAACAGCGGCAGGGCGGG - Intergenic
950707777 3:14793638-14793660 CCCCGAGGCCCCGCCTGGGCGGG - Intergenic
950773589 3:15331915-15331937 CCGCGGTGCCGCGGCCGGGCAGG + Intronic
953404680 3:42654545-42654567 CCCCGGGGGCGCGGCCAGGCAGG - Intronic
953867111 3:46593618-46593640 CCCCGGGGATGCGGCTGGCCAGG - Intronic
953901212 3:46845292-46845314 CCCAGGGCCCTGGGCAGGGCTGG + Intergenic
954147310 3:48640773-48640795 TCCCGGGGCAGGGGGAGGGCGGG + Intronic
954367651 3:50154961-50154983 CCCCGGGGGTGGGGCTGGGCGGG + Intergenic
954708912 3:52495408-52495430 CCCCGGGGCCCCGCCATGGCTGG - Exonic
954746786 3:52791938-52791960 CCCCGGGGCCAAGGCAGAGGAGG + Exonic
954800260 3:53183211-53183233 GCCTGGGTCCGGGGCAGGGCTGG + Intronic
955190263 3:56755177-56755199 CACGGGGGCAGCGGCAGGACTGG + Intronic
956761374 3:72447447-72447469 CCCCGGGGCGGCTTCGGGGCCGG - Intergenic
958004289 3:87792773-87792795 GCCCCGGGGCGCGGGAGGGCAGG - Intergenic
960586138 3:119322940-119322962 CTGCGGGGCGGGGGCAGGGCTGG - Intronic
961236888 3:125375058-125375080 GCCCGGGCCCGGGGGAGGGCGGG - Intronic
961346642 3:126267681-126267703 CCACGGGCGCGCGGCTGGGCCGG - Intergenic
961377271 3:126475488-126475510 CGCCGGGGCTACGCCAGGGCCGG + Exonic
961389202 3:126542417-126542439 CCCCGGGGCCGCGGCGGCCCAGG - Exonic
961666837 3:128497938-128497960 GGCCGGGGCCGGGGCAGGGGAGG - Intergenic
963904453 3:150762656-150762678 CCCGGCGGCGGCGGCGGGGCCGG - Exonic
964118974 3:153162652-153162674 CGACGGGGCCGCGGCAGGCGCGG + Exonic
967035366 3:185645346-185645368 CCCAGGGGCCGAGGAGGGGCGGG - Exonic
967858512 3:194135079-194135101 CGCCGCGGCTGCGGCCGGGCCGG - Intergenic
967884796 3:194325952-194325974 CCCCGGGGCTGGGGAAGGGCCGG - Intergenic
968230916 3:197003868-197003890 ACCAGGGGAGGCGGCAGGGCGGG + Intronic
968434011 4:575837-575859 CCCGGGGTCCGCAGCAGAGCAGG + Intergenic
968541859 4:1172039-1172061 GCCCAGGGCGGCGGCCGGGCTGG + Exonic
968601694 4:1512820-1512842 CCCTGGGGCAGCGCCAGTGCGGG + Intergenic
968603669 4:1521489-1521511 CCACGGGGCCCCGGCGGGGGCGG - Intergenic
968622323 4:1609350-1609372 CCCCGGGGCAGGTGCAGGCCTGG - Intergenic
968674681 4:1871231-1871253 CGCCGGGGCCGCGCACGGGCGGG - Intergenic
968879504 4:3292069-3292091 CCCTGGGCGGGCGGCAGGGCTGG + Intergenic
969240333 4:5893004-5893026 GCCCAGGGCCGCGGGCGGGCAGG - Exonic
969315392 4:6378633-6378655 CTCCGGGGACCCAGCAGGGCCGG + Intronic
969417068 4:7067866-7067888 CTCCGGGGCCGAGGCCGGGAAGG + Intronic
969626972 4:8310619-8310641 CCCCAGTGCCGGGGCAGAGCAGG + Intergenic
969652812 4:8477903-8477925 CCAGGAGGCGGCGGCAGGGCTGG - Intronic
969691580 4:8706909-8706931 CCCCCGGGCCCCGGCGGGGCTGG - Intergenic
970333284 4:15004656-15004678 CGCCGGGGCCGCGGGCGGCCGGG + Intronic
970456061 4:16226023-16226045 CCCCGCGGCCGCGCCAGGCCAGG - Intronic
972162486 4:36244150-36244172 ACCCGGGGCCTCGGGAAGGCTGG - Intronic
972532910 4:39977106-39977128 CCCCGGGTCCGAGGCTCGGCTGG - Intronic
978795712 4:112705900-112705922 ACTCGGGGCCGCGGCGGGCCGGG - Intergenic
981429797 4:144645870-144645892 CCCGGGGGCCGCGGCGAGGCGGG + Intergenic
981475288 4:145180825-145180847 CCGCGGCGCAGCGGCAGGGTTGG - Intergenic
981531910 4:145761727-145761749 CCCCTGAGAGGCGGCAGGGCTGG - Intronic
984639255 4:182144517-182144539 GCCCGGGGACGCGGGAGGGGAGG - Intronic
984928381 4:184826092-184826114 GGGCGGGGCCGCGGGAGGGCGGG - Intronic
985530175 5:429478-429500 CCAGGGGGCAGGGGCAGGGCCGG - Intronic
985592657 5:773654-773676 CACCTGGGTCGGGGCAGGGCTGG - Intergenic
985608861 5:875133-875155 TCCCGGGCCCTCGGCAGGACGGG - Intronic
985928468 5:3035937-3035959 CACCTGGGCCTAGGCAGGGCAGG - Intergenic
985995887 5:3596537-3596559 CCCCGGGGACGCAAGAGGGCTGG + Intronic
987374014 5:17217833-17217855 CCCCGGGTCCGCGGCGGCGCGGG - Intronic
987374228 5:17218589-17218611 CCCCGGGCCCGGGCCGGGGCCGG - Intronic
989089725 5:37717714-37717736 CCCTGAGACTGCGGCAGGGCTGG - Intronic
990456614 5:55994987-55995009 CCCCAGTCCCGCGGCGGGGCGGG + Exonic
992104417 5:73437664-73437686 GCCCGGGGCCCCGGCAGCTCCGG - Intergenic
992473181 5:77077501-77077523 CTCGGGGGCCGCAGCGGGGCCGG + Exonic
994171402 5:96662602-96662624 CCCCGGCGCCCCCGCGGGGCAGG + Intronic
995379087 5:111512352-111512374 CCACGGAGCCGCGGCAGGATTGG - Intronic
996379045 5:122845523-122845545 CCCCGCGGGCGCAGCGGGGCGGG + Exonic
999153207 5:149440513-149440535 CCCCAGGGCCAAGGCAGTGCAGG - Intergenic
999300109 5:150485871-150485893 CCCCGGGGCGGGGGCCGGGGCGG - Intronic
999327065 5:150650106-150650128 CGCGAGGGCCGAGGCAGGGCAGG - Exonic
1001561151 5:172669816-172669838 GGCCGGGGCCGCAGCACGGCCGG - Exonic
1001822505 5:174721098-174721120 CAGCGGGGGCGGGGCAGGGCGGG + Intergenic
1002154442 5:177265536-177265558 CCCCTGGGCCCGTGCAGGGCGGG + Intronic
1002426834 5:179181517-179181539 CCCCGCGGCACAGGCAGGGCTGG + Intronic
1002524306 5:179806872-179806894 CCTCGCCTCCGCGGCAGGGCCGG + Intronic
1002541230 5:179907715-179907737 CGCCGGGGCCACGGCAGGGGCGG - Exonic
1003911491 6:10747768-10747790 CCCCGGGGCCGCGGCAGGGCGGG - Exonic
1004924054 6:20402375-20402397 GCCCGGGGCGGCGGCAGCGGCGG - Exonic
1005826238 6:29633049-29633071 CCCCGGGGCGGCGGCAGCCACGG + Exonic
1005926681 6:30451129-30451151 GCCCGGGGCCACCGCTGGGCGGG - Intergenic
1006408186 6:33857095-33857117 CCCCTGGGCCCGGCCAGGGCTGG + Intergenic
1006717673 6:36130708-36130730 CCCCTGGGCCGCTGGGGGGCGGG + Intronic
1006788620 6:36684337-36684359 CCACGGGGCCCCGGCGAGGCCGG + Exonic
1007485572 6:42178658-42178680 CCCGGGGGCCTAGGCAGAGCTGG - Intronic
1007557904 6:42782436-42782458 TCCCGGGGCCCCGGCAGCGCTGG - Intronic
1007625383 6:43243620-43243642 CCCCGGGGCCGGGGCGGGGCGGG - Intergenic
1007633062 6:43283431-43283453 CCCGGGGCCTGGGGCAGGGCTGG + Exonic
1011633915 6:89352882-89352904 CCGGGCGGCCGCGGCAGGGCTGG - Intergenic
1013048897 6:106512698-106512720 CCCGGGGGCCGCTGGCGGGCGGG - Exonic
1013372676 6:109483558-109483580 GGCCGGGGCCGGGGCAGGGCGGG + Intergenic
1014535660 6:122610497-122610519 CGCCAGGGCACCGGCAGGGCAGG + Intronic
1015749960 6:136550009-136550031 ACCCGAGGCCGCGGCGGGGAGGG + Intronic
1016328177 6:142926823-142926845 CCCGGCGGCCGCCGCAGGGCCGG - Intronic
1016448322 6:144155329-144155351 CCTGGGGGCAGCGGCAGGGGCGG + Intronic
1017021484 6:150143345-150143367 CACGGCGGCCGCTGCAGGGCAGG + Exonic
1017716966 6:157219373-157219395 CCCCGGGGAAAGGGCAGGGCAGG - Intergenic
1018613268 6:165662818-165662840 TCCCCGGGCCGCGGAGGGGCAGG + Intronic
1018727757 6:166627033-166627055 GCCCGGAGCAGCCGCAGGGCCGG + Intronic
1019143389 6:169962111-169962133 CACCGGGGCGGCCGCAGAGCAGG + Intergenic
1019343183 7:518067-518089 CGCTAGGGCCGCGGCTGGGCCGG - Intronic
1019416911 7:932036-932058 CCCCGGCCCCCAGGCAGGGCTGG - Intronic
1019461283 7:1160244-1160266 CCACTGGGCCGCGGCCTGGCGGG - Intronic
1019518579 7:1450453-1450475 CACCGTGGCCGGAGCAGGGCCGG - Intronic
1019563868 7:1670329-1670351 CCCCGGAACCGAGGCCGGGCGGG + Intergenic
1019578832 7:1750257-1750279 CCGGGGGGCCGGGGCCGGGCTGG - Intergenic
1020107634 7:5429464-5429486 CTGGGGCGCCGCGGCAGGGCTGG - Intergenic
1020278333 7:6637573-6637595 CCGCGGGGAGGCGGCGGGGCCGG + Intronic
1021106786 7:16646527-16646549 CCCTGGGACCGCGGGCGGGCGGG + Intronic
1022449788 7:30504377-30504399 CACCGTGGCCCGGGCAGGGCCGG + Intronic
1022973481 7:35537293-35537315 CTCTGGGCCCGCGGCAGGGCGGG + Intergenic
1023609206 7:41957024-41957046 CCACAGAGCCGCGGCAGGGTGGG + Intergenic
1023779376 7:43641971-43641993 TCCCGGGGCAGGGGCAGGGGAGG + Intronic
1024579953 7:50793348-50793370 CCCCTGGGTGGCGGCAGCGCCGG - Intronic
1026471158 7:70694760-70694782 GCCCGGGGCCTCGGCCGCGCTGG + Intronic
1026850356 7:73719716-73719738 CCCGGGGGCCGGGGCGGGGCCGG - Intergenic
1027187741 7:75981989-75982011 CCCAGAAGCCGGGGCAGGGCTGG - Intronic
1027215048 7:76178324-76178346 TCCCGGGGCTGGAGCAGGGCTGG - Intergenic
1027266636 7:76498379-76498401 CCCCAGGGCAGGGGAAGGGCAGG - Intronic
1027318017 7:76996497-76996519 CCCCAGGGCAGGGGAAGGGCAGG - Intergenic
1029206011 7:98869783-98869805 GCCCTGGGCCCCGGCAGGGGTGG - Exonic
1029280236 7:99430680-99430702 CCCCAGGGCTGCTGCTGGGCAGG - Intronic
1029372554 7:100158626-100158648 CCCCGGTGCCGGGACCGGGCCGG - Exonic
1029711474 7:102302361-102302383 CCCCTGGGCAGGGGCTGGGCTGG - Intronic
1030033341 7:105388540-105388562 CCCCGGGCCGGCGGGCGGGCTGG - Intronic
1031483180 7:122302018-122302040 CCCCGGGGCCCCTGCAGCCCGGG - Exonic
1031629884 7:124033137-124033159 CCGCGGGACCGCGGCCGGGACGG - Intergenic
1032094209 7:128929536-128929558 CCCCTGGCCCCTGGCAGGGCTGG - Intergenic
1032391300 7:131556738-131556760 GGCCGGGGCCGGGGCTGGGCGGG + Intronic
1032649020 7:133857644-133857666 CCCAGCTGCTGCGGCAGGGCAGG + Intronic
1033654046 7:143361831-143361853 CCCGGCCGCCGAGGCAGGGCCGG + Intronic
1033683702 7:143620647-143620669 CCCCGGGCCCGCCTCAGGGTCGG + Intergenic
1033700910 7:143836991-143837013 CCCCGGGCCCGCCTCAGGGTCGG - Intergenic
1034228045 7:149497877-149497899 CCCCGCGGGCGGGGCTGGGCGGG - Intergenic
1034422382 7:150996466-150996488 CCGGGGGGCCGGGGGAGGGCCGG - Exonic
1034469761 7:151248915-151248937 CCCAGCGCCCGCGGCCGGGCTGG - Exonic
1034478697 7:151303586-151303608 CGCAGGGGCTGCGGCTGGGCGGG + Intergenic
1034560627 7:151877330-151877352 CCCTGGGGCCGCGGCGCGGCGGG - Intergenic
1035020137 7:155796131-155796153 CCCAGGGGCCGGGCCAAGGCTGG - Intergenic
1035637013 8:1155133-1155155 CCCTGGGGCAGCGGCTGGCCGGG + Intergenic
1035719430 8:1780583-1780605 CTCCGGGGCGGCAGCAGAGCTGG + Exonic
1035748823 8:1980724-1980746 CGCCAGGGCAGGGGCAGGGCAGG + Intronic
1036189998 8:6661606-6661628 CCCAGGGGCCCTGGGAGGGCGGG + Intergenic
1036381464 8:8238640-8238662 TCTGGGGGCTGCGGCAGGGCAGG - Intergenic
1036454093 8:8893051-8893073 GCCCGGGGCCCCGCCATGGCTGG - Exonic
1036664559 8:10730324-10730346 CCCGGGGGCCGGGGGACGGCCGG + Intronic
1037262781 8:17027132-17027154 CCCCGGGGCCGCGCGAGTGTAGG + Intergenic
1037584206 8:20265302-20265324 CCCCAGGGTAGCGGCATGGCAGG + Intronic
1037589953 8:20303969-20303991 TCCCGGAGCCGGGGCGGGGCGGG + Intergenic
1038017724 8:23529322-23529344 CCCCAGGACCGCGGCTGGCCGGG + Intronic
1039542507 8:38382989-38383011 CCTCCGGGCCGCAGCAGAGCAGG - Intergenic
1039996894 8:42541777-42541799 CCCCGCGTCCGGGGCGGGGCGGG - Intronic
1041381901 8:57260175-57260197 CCCCGTAGCCGCAGGAGGGCGGG + Intergenic
1041734485 8:61095351-61095373 CCCCAGAGCAGGGGCAGGGCTGG + Intronic
1042155563 8:65841539-65841561 GCCGGCGGCCGCGGCAGGGCGGG - Exonic
1042307175 8:67343856-67343878 TCCCGGCGCCGCGGCAGCTCTGG - Intergenic
1044591512 8:93917503-93917525 CCCCTGGGGCGGGGCCGGGCCGG + Intronic
1044698972 8:94949421-94949443 GCCCCGGGCCGCGCCAGGCCGGG + Intronic
1045111507 8:98941919-98941941 CCCCGGGGCCGCGGCAGGAATGG + Intronic
1045277636 8:100721854-100721876 CTGCGGGGCCGCGGGCGGGCGGG + Exonic
1046260290 8:111758854-111758876 CCCTGGGGCTCCGGCACGGCAGG + Intergenic
1048244131 8:132775373-132775395 GCCCGGCGTCGCGTCAGGGCTGG + Exonic
1048292186 8:133189722-133189744 CCCAGGGGCCACGCCAGGACTGG + Intergenic
1049209445 8:141378789-141378811 CACCTGGGCAGGGGCAGGGCAGG + Intergenic
1049212169 8:141391889-141391911 CCCCGAGGCCGCCCCTGGGCTGG - Intergenic
1049229620 8:141475194-141475216 CCCTGGGGCCGCTGCTGGGAAGG + Intergenic
1049508994 8:143018466-143018488 CCCCGGGGCGGGGGCAGGGGCGG - Intronic
1049578142 8:143398902-143398924 CCCCAGGGCAGCTGCAGTGCCGG - Intergenic
1049611897 8:143559697-143559719 CCCTGGGGCTGGGACAGGGCTGG + Intronic
1049615630 8:143574711-143574733 CTCCCGGGCTGCGGCTGGGCTGG - Intergenic
1049681755 8:143921894-143921916 CCCCGCGGCAGAGGCAGAGCCGG - Exonic
1049752225 8:144290734-144290756 CCCCTCGGCCGCGGCCGCGCTGG - Intronic
1049788492 8:144462540-144462562 GCCCGGGGCGGCCGCCGGGCAGG - Intronic
1049803647 8:144529295-144529317 CGCCCAGGCCTCGGCAGGGCTGG + Exonic
1049891352 9:73390-73412 CCCCGGAGCCGCAGCAGGACCGG - Intergenic
1050388144 9:5111655-5111677 CCACAGGGCCGCTGCTGGGCGGG - Intronic
1053163531 9:35829424-35829446 GCCCGGGGCGGGGGCGGGGCCGG - Intronic
1055454420 9:76459401-76459423 CCCCGTGGCCCCGGGCGGGCTGG + Intronic
1056243493 9:84670776-84670798 CCCCAGAGCCGCGCCATGGCGGG - Exonic
1056676891 9:88683464-88683486 CCCCGGCGCCGCGGGAGGAGAGG - Intergenic
1057208031 9:93184812-93184834 CTCCGCGGCCGGGGCTGGGCAGG + Intergenic
1057337434 9:94166612-94166634 CCGCGTGGCCGCCGCGGGGCCGG + Intergenic
1057466252 9:95317267-95317289 CCGCGGGGCGGGGCCAGGGCGGG - Intronic
1057619159 9:96619586-96619608 TCCCGCGGCCGCCGCAGGACCGG + Exonic
1058432005 9:104928076-104928098 CTCCCGGGCTGCGGCAGGGCAGG - Exonic
1059176731 9:112175142-112175164 CCGCGGCGCCGCGGGAGCGCCGG - Exonic
1059191862 9:112333938-112333960 CCGCGGGGCCGCGGGAGGGCGGG - Intergenic
1059432807 9:114260123-114260145 CCCCGCGCCTGAGGCAGGGCAGG - Intronic
1060161534 9:121369685-121369707 CCCTGGGGCCAGGCCAGGGCTGG + Intronic
1060986045 9:127819566-127819588 CCCAGGGGCTGCTGCTGGGCCGG - Intronic
1061037318 9:128120933-128120955 CCCCAGGGCAGTGGCAGGGCTGG + Exonic
1061450479 9:130664616-130664638 CCCCGGCGCCGGGGGACGGCCGG - Exonic
1061559526 9:131393917-131393939 CCCGGGGGCCGGGCGAGGGCTGG - Intergenic
1061760318 9:132846808-132846830 ACCGGGGGAAGCGGCAGGGCTGG - Intronic
1061987094 9:134136179-134136201 CCCCGCCGCCGCGGCCCGGCAGG + Exonic
1062022726 9:134326844-134326866 TCGCGGGGCCGGGGCGGGGCTGG + Intronic
1062312765 9:135948175-135948197 CACAGGGACCGTGGCAGGGCTGG + Intronic
1062349647 9:136132682-136132704 CGCTGGGGCCGCGGCTCGGCTGG + Intergenic
1062376473 9:136264040-136264062 CCCCAGGGCCCACGCAGGGCTGG + Intergenic
1062390037 9:136330200-136330222 CCCCGGGGCTGGGGCCGGGAAGG + Intronic
1062401032 9:136372725-136372747 CCCCGCAGCTGCAGCAGGGCTGG - Intronic
1062452451 9:136621306-136621328 CCAAGGAGCCGTGGCAGGGCAGG - Intergenic
1062549216 9:137078265-137078287 CCTCCGGGCCGAGGTAGGGCAGG - Intronic
1062578059 9:137217737-137217759 CCCCAGGGCGGCGACAGGGGCGG - Intergenic
1062670528 9:137706116-137706138 ACACGGGGCCATGGCAGGGCAGG + Intronic
1062696294 9:137877883-137877905 CCCAGCGGCCCCGGCAGGGAGGG - Exonic
1203773877 EBV:62264-62286 CCCCTGGGCGGCTGCAGGGCAGG - Intergenic
1185483953 X:468274-468296 CCCCGGCACTGGGGCAGGGCAGG - Intergenic
1185877728 X:3713669-3713691 CCCCGCGGCCGGGTTAGGGCGGG - Intergenic
1186425983 X:9464879-9464901 CCGCGGGGGAGGGGCAGGGCCGG + Intronic
1187507289 X:19887799-19887821 GGCCGGGGCCGCGTCGGGGCAGG + Intergenic
1187826286 X:23335261-23335283 CGCCGCGGCCGCGGTCGGGCTGG + Intronic
1190061684 X:47215686-47215708 GGCTGGGGCGGCGGCAGGGCCGG - Intergenic
1190337264 X:49270031-49270053 CCCCGGGCCCGCCCCACGGCCGG - Exonic
1190385633 X:49879957-49879979 CGCCGGGGCCGGGGCCGGGGCGG - Exonic
1190385642 X:49879968-49879990 CCCCAGGGCCGCGCCGGGGCCGG - Exonic
1192784913 X:74326003-74326025 CTCAGGGGCCGGGGCGGGGCGGG - Intergenic
1198727262 X:139691277-139691299 CAGCAGGGCCGTGGCAGGGCAGG - Intronic
1200107788 X:153724453-153724475 CTCCGGGGCCTCGCGAGGGCTGG - Intronic
1200142822 X:153910290-153910312 ACCCGGTGGCGCTGCAGGGCCGG - Exonic