ID: 1003918887

View in Genome Browser
Species Human (GRCh38)
Location 6:10813440-10813462
Sequence GGAATTTCTGGCTGGCACGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 239}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003918887 Original CRISPR GGAATTTCTGGCTGGCACGG TGG (reversed) Intronic