ID: 1003923686

View in Genome Browser
Species Human (GRCh38)
Location 6:10856891-10856913
Sequence ATTCATAAGCCCAATGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 99}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003923686_1003923688 29 Left 1003923686 6:10856891-10856913 CCTGCATCATTGGGCTTATGAAT 0: 1
1: 0
2: 1
3: 6
4: 99
Right 1003923688 6:10856943-10856965 CTATATGCCAAGCCCTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003923686 Original CRISPR ATTCATAAGCCCAATGATGC AGG (reversed) Intronic
902773653 1:18660716-18660738 ATTCCTGAGCCCAAGGAGGCAGG - Intronic
905221124 1:36448660-36448682 ATTCTTAAGCCGAATAATGCAGG + Intronic
905970703 1:42140111-42140133 CTTCCTCAGCCCTATGATGCGGG - Intergenic
909215531 1:72882997-72883019 ACTCCTAAGACCAATGAGGCTGG - Intergenic
917763383 1:178189427-178189449 ACTCATAAGACCAATGACTCAGG - Intronic
921256019 1:213340193-213340215 TTTCATGAGCCCTGTGATGCTGG + Intergenic
1064038117 10:11932312-11932334 ACTAATAAGCCTAATGATGATGG + Intronic
1064301071 10:14123352-14123374 ATCCAGAAACCCAAAGATGCTGG - Intronic
1064749520 10:18512399-18512421 ATACACAAGGCCAATGATTCAGG - Intronic
1065039664 10:21679478-21679500 ATTCATTAACCCATTTATGCTGG + Intronic
1065349062 10:24779239-24779261 ATACATAATCCCAGTGATGCAGG + Intergenic
1069880896 10:71592520-71592542 AGTCACAAGCCAAGTGATGCTGG - Intronic
1073576652 10:104631502-104631524 CTTCCTCTGCCCAATGATGCGGG - Intergenic
1076116668 10:127906272-127906294 ATTCATAAGCCTAATGAGCTGGG + Intergenic
1076468666 10:130703352-130703374 ATTAATAAGCCAGTTGATGCAGG - Intergenic
1078461238 11:11516694-11516716 ATTAATAAGACCCATGCTGCAGG + Intronic
1079368419 11:19829582-19829604 CTTCATAATACCAATGATGTAGG + Intronic
1081984279 11:47290249-47290271 CTCCAAAAGCCCAAAGATGCTGG - Exonic
1093603723 12:21064117-21064139 ATTCATAAGCCAAAATATTCAGG - Intronic
1094612349 12:32006590-32006612 ATAAATCAGCCCAAGGATGCGGG - Intergenic
1099051736 12:77789279-77789301 ATTAATAAACCAAGTGATGCAGG - Intergenic
1099834465 12:87890667-87890689 ATTGATAAGCCAAGTTATGCAGG + Intergenic
1107024608 13:35786792-35786814 ATCCATAAGGCCAATTATGTAGG + Intronic
1115125166 14:29983555-29983577 ATTTATATGCTCAATGAAGCAGG - Intronic
1120635411 14:86944351-86944373 AGTCATAAGCCTAAGAATGCTGG - Intergenic
1123910455 15:24960595-24960617 AATCAAAATCCCAATGAGGCAGG - Intronic
1123917394 15:25046478-25046500 AATCCTAAGCACATTGATGCAGG - Intergenic
1124069229 15:26376084-26376106 ATTCATCAGCCGAATTAAGCTGG - Intergenic
1132135967 15:99339205-99339227 ATTAATAAGTCCAATTATCCAGG + Intronic
1132399206 15:101495212-101495234 ATTCAGCAGCTCAGTGATGCTGG + Intronic
1137279439 16:46963108-46963130 ATGCATAAGCCCAATGAACACGG - Intronic
1141258355 16:82425534-82425556 TTTAATAAGCCCCATGATACCGG - Intergenic
1147422551 17:40329748-40329770 AATCAAAAGCACAATGAGGCTGG - Intronic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1153420503 18:4899758-4899780 ATTCATCAGCAAAATAATGCCGG - Intergenic
1154281902 18:13010928-13010950 ATTCAAAACCACAATGAGGCTGG + Intronic
1157167174 18:45368518-45368540 AGTCATAAGCCCAATGTGGCAGG - Intronic
1163459159 19:17425842-17425864 ATTATTATGCCCAATGATGAAGG - Intronic
925025092 2:601267-601289 ATCCATAAGCCCAGTGCGGCAGG - Intergenic
927581731 2:24256775-24256797 GATCATAAGCTCAATGAGGCTGG - Intronic
928245336 2:29621810-29621832 ACTCATTCGCACAATGATGCTGG - Intronic
933835751 2:86244168-86244190 GTTCATAAGCCCAGTGATTTGGG - Intronic
936818255 2:116486394-116486416 ATTCATATGCCAAGTGATTCAGG + Intergenic
936944719 2:117920047-117920069 CTTCATAAGCGCAATGTTACTGG + Exonic
946700322 2:222406029-222406051 ATGAATTAGCCTAATGATGCAGG + Intergenic
947298296 2:228658110-228658132 ATTTAAAAGCCCACTGATTCTGG + Intergenic
947849990 2:233278849-233278871 ATTCATAAGCTAAATGTTTCTGG - Intronic
947900875 2:233720435-233720457 ATCTATAAGCCCAGTGAAGCTGG + Intronic
947902234 2:233730761-233730783 ATCTATAAGCCCAGTGAAGCTGG + Intronic
1170962217 20:21035572-21035594 ATTCAGTAGCACAGTGATGCTGG + Intergenic
1172996344 20:39072724-39072746 ATTCATCATACCAATGATGGAGG - Intergenic
1173455441 20:43197699-43197721 ACTGATAAGCCCAATGCTTCAGG + Intergenic
1177395684 21:20532989-20533011 ACTCGTAAGCCCAATGAAACAGG - Intergenic
1177662264 21:24100346-24100368 ATTCAAAAGATCAATGATCCAGG - Intergenic
1178778721 21:35578486-35578508 ATTCAGAAGACAAATGAGGCAGG + Intronic
1179401452 21:41087840-41087862 ATCCATAAGCCCAGGAATGCTGG - Intergenic
1183239541 22:36647047-36647069 ATCAATAAGGCCAATGATTCTGG + Intronic
1184392192 22:44210233-44210255 ATCCACAAGCCCAGAGATGCTGG - Intronic
1184971125 22:48020877-48020899 GTTCATGAGCCAAATAATGCAGG + Intergenic
1185265300 22:49899170-49899192 ACTCATAAGAAAAATGATGCAGG + Intergenic
949092095 3:40335-40357 ATGCAAAAGCCCATTGATGTTGG - Intergenic
949146499 3:707003-707025 TTTCAGAAGCCAAAAGATGCAGG + Intergenic
950257945 3:11521364-11521386 ACTCATAAACCCAAAGATGAGGG + Intronic
952078511 3:29728393-29728415 ATGTATATGCCAAATGATGCCGG + Intronic
952625463 3:35397429-35397451 ATTCATGAGCCCAAAAATGAGGG + Intergenic
952638303 3:35558011-35558033 ACCCATCAGCCCACTGATGCAGG + Intergenic
952743219 3:36754342-36754364 ATTAATAAGCCCACTGATTTTGG + Intergenic
955103450 3:55873985-55874007 ATTCATAAAACAAATCATGCTGG - Intronic
960021642 3:112962584-112962606 AGGATTAAGCCCAATGATGCAGG - Intronic
962860579 3:139396779-139396801 AATCATAAGGCAAATGATCCGGG + Intergenic
964950037 3:162279408-162279430 TTTCAAATGCTCAATGATGCAGG - Intergenic
967284787 3:187858543-187858565 TTTCATCAGCCCAATGAGGTGGG + Intergenic
969948041 4:10805058-10805080 ATTCCTTAGCCCAGTGAAGCTGG - Intergenic
971485840 4:27159238-27159260 ATTCATAACCCCACTGATAATGG - Intergenic
971587289 4:28420519-28420541 ATTCAAAAGCCCAGTGATCAGGG - Intergenic
982124860 4:152175621-152175643 TTTTCTTAGCCCAATGATGCAGG - Intergenic
986790699 5:11156850-11156872 ATTTAAAAGCCAAATGATGTTGG + Intronic
987492322 5:18596508-18596530 ACTCACCAGCACAATGATGCAGG + Intergenic
990476180 5:56163588-56163610 AGTCATAAGAGCACTGATGCTGG + Intronic
992118764 5:73568770-73568792 ATTCATAAGCCCCATGAAACTGG - Intronic
992701927 5:79349536-79349558 AATCATAAGCCACATGAGGCAGG - Intergenic
996058446 5:119006258-119006280 ATTCATAAGCACAATGATGTAGG + Intergenic
997096003 5:130912121-130912143 ATTCATCAGCCCAATACTGTAGG + Intergenic
1000252974 5:159512705-159512727 AGTCATAAGTTCAATGATTCTGG - Intergenic
1003923686 6:10856891-10856913 ATTCATAAGCCCAATGATGCAGG - Intronic
1004041607 6:11983785-11983807 ATTCATCGGCCCATTGATGCTGG - Intergenic
1006857529 6:37145674-37145696 GTTCACAAGCCCTCTGATGCTGG - Intergenic
1012299449 6:97566589-97566611 ATTCTAAAGTCCAATGAGGCAGG - Intergenic
1013033220 6:106356422-106356444 AATCAGAAGCTCAGTGATGCTGG - Intergenic
1023270105 7:38453333-38453355 ATGCATAACCCCAAGGCTGCTGG - Intronic
1023639323 7:42241654-42241676 ATTTATAATCCCAATGTTCCAGG - Intergenic
1024118247 7:46212904-46212926 TTTCAAAAGGCAAATGATGCAGG + Intergenic
1024194192 7:47042793-47042815 GTTCATGAGCCCAGTGATTCAGG - Intergenic
1026587029 7:71664149-71664171 ATGCAAAAGCCCAAGGATGTGGG - Intronic
1030670794 7:112334257-112334279 ATTCATGAGCCATCTGATGCAGG + Intronic
1035370116 7:158374319-158374341 ACTCAAAAGGCCAATGCTGCAGG + Intronic
1041091694 8:54307371-54307393 ATTCCTAAGCCCAAGAAGGCTGG + Intergenic
1044362538 8:91305022-91305044 ATTCAGAAGCCCTATGAGGTAGG - Intronic
1045809850 8:106208799-106208821 TTTTATAAGCACAATGATGCTGG + Intergenic
1046498995 8:115051683-115051705 AAACATAAGCCCAATGTTACAGG + Intergenic
1050620341 9:7445719-7445741 TTCCATAAACCCAGTGATGCAGG + Intergenic
1057594946 9:96407784-96407806 ATTCATCAGGCCAATGAGACGGG + Intronic
1190371584 X:49747629-49747651 ATTCACAAGCACAAATATGCTGG + Intergenic
1191967010 X:66769828-66769850 TTTCAGAAGCCCACTGATCCTGG + Intergenic
1195497885 X:105559175-105559197 ATTAATGAGGCCAATGCTGCAGG + Intronic
1197559813 X:128005565-128005587 ATTTATAAGCTCTATAATGCAGG + Intergenic
1199745569 X:150770126-150770148 TTTCAGGAGCCCAAAGATGCTGG - Intronic