ID: 1003925338

View in Genome Browser
Species Human (GRCh38)
Location 6:10872280-10872302
Sequence TTTTGGCAATGGAAGTTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003925335_1003925338 22 Left 1003925335 6:10872235-10872257 CCAGTAAGTGCTATATAAATGTT 0: 1
1: 0
2: 8
3: 52
4: 395
Right 1003925338 6:10872280-10872302 TTTTGGCAATGGAAGTTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003925338 Original CRISPR TTTTGGCAATGGAAGTTCAA AGG Intronic
No off target data available for this crispr