ID: 1003926390

View in Genome Browser
Species Human (GRCh38)
Location 6:10881768-10881790
Sequence GCTTCCTGCACCGCGGCCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 280}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003926382_1003926390 15 Left 1003926382 6:10881730-10881752 CCCAGCTGAGCTGCATCCCGTAG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1003926390 6:10881768-10881790 GCTTCCTGCACCGCGGCCGCCGG 0: 1
1: 0
2: 1
3: 22
4: 280
1003926385_1003926390 -1 Left 1003926385 6:10881746-10881768 CCCGTAGGAGCACACGCCGACCG 0: 1
1: 0
2: 0
3: 1
4: 10
Right 1003926390 6:10881768-10881790 GCTTCCTGCACCGCGGCCGCCGG 0: 1
1: 0
2: 1
3: 22
4: 280
1003926386_1003926390 -2 Left 1003926386 6:10881747-10881769 CCGTAGGAGCACACGCCGACCGC 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1003926390 6:10881768-10881790 GCTTCCTGCACCGCGGCCGCCGG 0: 1
1: 0
2: 1
3: 22
4: 280
1003926383_1003926390 14 Left 1003926383 6:10881731-10881753 CCAGCTGAGCTGCATCCCGTAGG 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1003926390 6:10881768-10881790 GCTTCCTGCACCGCGGCCGCCGG 0: 1
1: 0
2: 1
3: 22
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003926390 Original CRISPR GCTTCCTGCACCGCGGCCGC CGG Exonic
900297313 1:1958302-1958324 TCTTCCTGCCCCGCTGACGCAGG + Intronic
900466984 1:2830580-2830602 GTTACCTGCACCGTGGCCGGAGG - Intergenic
901086002 1:6613102-6613124 GCTCCCTGCTCCGGGCCCGCGGG - Intronic
901534280 1:9872321-9872343 GCTTCATGCACAGAGGCAGCAGG - Intronic
902861671 1:19251436-19251458 TCTTCGTAGACCGCGGCCGCAGG + Exonic
903750397 1:25617449-25617471 CCTTCCCGCGCTGCGGCCGCCGG - Exonic
903907486 1:26696765-26696787 GCTGCCGCCACCGCCGCCGCCGG - Exonic
904542062 1:31239807-31239829 GCCTCCTGCCCCGGGGCGGCTGG + Intergenic
904591559 1:31618067-31618089 CCTTCCTGCACCTCGGGGGCTGG - Intronic
904724318 1:32535371-32535393 GCTTCCTGCATCATGGCAGCTGG - Intronic
905212701 1:36385639-36385661 GATTCCACCGCCGCGGCCGCCGG + Intronic
909759312 1:79269536-79269558 GGATCCTGCACCGGGGCTGCAGG - Intergenic
912764347 1:112395694-112395716 GCTTCCAGCACCACGCCCACAGG + Intergenic
913164855 1:116175608-116175630 GCTTCTTCCACCGCTGCCTCTGG - Intergenic
913469074 1:119171921-119171943 GGATCCCGCACCGGGGCCGCAGG - Intergenic
913470257 1:119179440-119179462 GGATCCTGCACCAGGGCCGCAGG - Intergenic
915141615 1:153771748-153771770 GCTGCTTGCACAGTGGCCGCAGG - Intronic
916605876 1:166342804-166342826 GGATCCTGCACCAGGGCCGCAGG + Intergenic
918154649 1:181832827-181832849 GGATCCTGCACCAGGGCCGCAGG - Intergenic
919631019 1:199960036-199960058 GGTTCCCGCACTGGGGCCGCAGG - Intergenic
919789208 1:201279504-201279526 ACTTCCTGGACAGCGGCCACGGG - Intergenic
922794512 1:228333439-228333461 GCCTCCTGCACCCAGGCAGCAGG - Intronic
923573894 1:235140710-235140732 GGATCCTGCACCGGGGCTGCAGG - Intronic
1065995584 10:31056236-31056258 GGATCCTGCACCAGGGCCGCAGG - Intergenic
1066780636 10:38942185-38942207 GCTTCTTGCCCCGCCGCCGCGGG + Intergenic
1068211403 10:53924595-53924617 GGATCCTGCACTGGGGCCGCAGG - Intronic
1070179231 10:73998334-73998356 GCCGCCTGCACGGCGGCCACGGG - Exonic
1070564017 10:77590225-77590247 GGATCCCGCACCGGGGCCGCAGG + Intronic
1071797012 10:89018598-89018620 GGATCCTGCACCGGGGCTGCAGG + Intergenic
1074732537 10:116393768-116393790 GGATCTTGCACCGGGGCCGCAGG - Intergenic
1074999306 10:118783319-118783341 GCATCCCGCACCGGGGCTGCAGG - Intergenic
1075654762 10:124153443-124153465 GCTTCCAGCCCAGCGCCCGCAGG - Intergenic
1076366899 10:129926977-129926999 GCATCCTCCACCGTGGCCCCAGG + Intronic
1076767483 10:132644497-132644519 GCGCCCTGGACCGTGGCCGCTGG + Intronic
1077415068 11:2420998-2421020 GCTCCCAGCACCACGACCGCTGG - Intronic
1080107426 11:28525741-28525763 GGATCCCGCACCGGGGCCGCAGG + Intergenic
1080457010 11:32427418-32427440 CCGTCCTGCACCCCGGCCGGGGG + Intronic
1081126861 11:39333013-39333035 GGATCCTGCACCGGGGCCGCAGG + Intergenic
1082698684 11:56401864-56401886 GGATCCTGCACCGGGGCTGCAGG + Intergenic
1083160806 11:60853006-60853028 GGTTGCAGCACCGCGGCCGCCGG - Exonic
1083546185 11:63550620-63550642 GGATCCTGCACCGGGGCTGCAGG - Intergenic
1083618446 11:64037326-64037348 GCTGCCTCCCCCGCGGCCGCCGG - Intronic
1083855373 11:65390581-65390603 GCTTCCTGCTCAGCTGCTGCTGG + Intronic
1083941866 11:65900248-65900270 GCTGCCTGCGCTGCGGCCGGGGG + Exonic
1084831799 11:71775111-71775133 GGATCCTGCACTGGGGCCGCAGG - Intergenic
1086397673 11:86433467-86433489 GGATCCCGCACCGGGGCCGCAGG + Intergenic
1086808095 11:91269172-91269194 GGATCCTGCACCGGGGCTGCAGG - Intergenic
1090619492 11:128548775-128548797 GCTGCCAGCAACGCGGGCGCAGG - Intronic
1092219157 12:6700901-6700923 GACTCCTGCAGCGCGGCAGCAGG - Intergenic
1093346326 12:18040627-18040649 GGATCCTGCACCAGGGCCGCAGG - Intergenic
1094470148 12:30795712-30795734 GCTTGCTGCACGGCAGCCGTGGG + Intergenic
1095478573 12:42610891-42610913 GGATCCTGCACCAGGGCCGCAGG + Intergenic
1096105437 12:48994865-48994887 GCTGCCGGCTCCGCGGGCGCGGG - Intergenic
1096994338 12:55829595-55829617 CCTTCCGTCCCCGCGGCCGCCGG + Exonic
1102309837 12:111836069-111836091 GGATCCTGCACCCGGGCCGCAGG - Intergenic
1105837524 13:24224082-24224104 GCAACCTGCACCGTGGCCCCCGG + Exonic
1109563094 13:64077479-64077501 GGATCCTGCACCGGGGCTGCAGG + Intergenic
1109745891 13:66622365-66622387 GGCTCCTGCACCGGGGCTGCAGG - Intronic
1111119340 13:83824664-83824686 GCTTCCTGCAAGGCTGCAGCTGG - Intergenic
1112094385 13:96116156-96116178 GCTTCCGGGAACTCGGCCGCAGG + Intronic
1112282625 13:98076279-98076301 GGATCCTGCACCCGGGCCGCAGG + Intergenic
1113538790 13:111090263-111090285 GCTCCCTGCACTGCAGCCTCCGG + Intergenic
1113940923 13:114018277-114018299 GGTTCCTGCACCCCGGGCCCTGG - Intronic
1113949966 13:114066388-114066410 GCCTCCCGCTCCTCGGCCGCTGG - Intronic
1114560237 14:23584825-23584847 GGATCCTGCACCGGGGCTGCAGG + Intergenic
1115118367 14:29909428-29909450 GGATCCTGCACCCAGGCCGCAGG - Intronic
1116311080 14:43327019-43327041 GGATCCTGCACAGGGGCCGCAGG - Intergenic
1116919689 14:50560199-50560221 GCTGCCTTCTCCGGGGCCGCAGG - Exonic
1117252802 14:53953112-53953134 GCTTCCAGCGCCCCGGCTGCCGG + Intronic
1118339112 14:64879873-64879895 GCTCCTGGCACAGCGGCCGCCGG + Exonic
1118592564 14:67412211-67412233 ACTTCCTGCCCCGGGGCCTCAGG - Intergenic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1122122765 14:99563323-99563345 GCTCCCTGCACCGCGCCATCTGG - Intronic
1122718337 14:103708252-103708274 GCTTCCTGCACCCCCTCCTCTGG + Intronic
1124036430 15:26057289-26057311 GGATCCTGCACTGGGGCCGCAGG - Intergenic
1124818402 15:33019430-33019452 GGATCCTGCACCGGGGCCGCAGG + Intronic
1127916511 15:63459463-63459485 GGATCCTGCACCGGGGCCGCAGG - Intergenic
1128453632 15:67821214-67821236 GTTTCCAGCAGCCCGGCCGCGGG - Intronic
1128657681 15:69474435-69474457 GCTTCCTGCACTGCCTCCACGGG - Intergenic
1129373940 15:75115940-75115962 GGATCCTGCACCGGGGCTGCAGG + Intronic
1129377638 15:75144213-75144235 GCTTCCTGCAAGGCTGCAGCTGG + Intergenic
1131012630 15:89031643-89031665 GGATCCCGCACCGGGGCCGCAGG + Intergenic
1131515340 15:93073124-93073146 GCTCCGTCCACCTCGGCCGCGGG + Intronic
1131992314 15:98104209-98104231 GGATCCTGCACCGGGGCGGCAGG + Intergenic
1132044277 15:98550129-98550151 GGATCCTGCACGGAGGCCGCAGG - Intergenic
1132365307 15:101252239-101252261 GCTTCCCGCACCGCGGCGCCCGG + Intergenic
1132613418 16:828832-828854 GCCTGCTGCTCCGGGGCCGCTGG + Intergenic
1133367460 16:5221954-5221976 GGATTCTGCACCGGGGCCGCAGG + Intergenic
1133801991 16:9091885-9091907 GCCTCCTGCACCCCGACGGCCGG - Exonic
1135280933 16:21153014-21153036 GGCTCCTGCACCGGGGCTGCAGG - Intronic
1135942626 16:26836043-26836065 GGATCCTGCACCAGGGCCGCAGG + Intergenic
1136711573 16:32241238-32241260 CCTGCCTGGGCCGCGGCCGCCGG + Intergenic
1136756342 16:32688167-32688189 CCTGCCTGGGCCGCGGCCGCCGG - Intergenic
1136811770 16:33182207-33182229 CCTGCCTGGGCCGCGGCCGCCGG + Intergenic
1136818246 16:33292287-33292309 CCTGCCTGGGCCGCGGCCGCCGG + Intronic
1136824810 16:33348820-33348842 CCTGCCTGGGCCGCGGCCGCCGG + Intergenic
1136829876 16:33447591-33447613 CCTGCCTGGGCCGCGGCCGCCGG + Intergenic
1136957411 16:34802855-34802877 GCTTTTTGCACCACCGCCGCCGG + Intergenic
1137442586 16:48509104-48509126 GGATCCCGCACCGGGGCCGCAGG - Intergenic
1137531755 16:49282386-49282408 GCGCCCTGCACCCCGGCCGCCGG - Intergenic
1138688863 16:58749273-58749295 GGATCCCGCACCACGGCCGCAGG - Intergenic
1139361514 16:66402671-66402693 GCTTCCGGAGCCGCCGCCGCAGG - Exonic
1139530010 16:67538161-67538183 CCTTCCTGCCCCGCGGCAGGCGG + Intronic
1139600357 16:67982639-67982661 GGATGCTGCACCGGGGCCGCAGG - Intergenic
1141762553 16:86038442-86038464 GCTCCCTGCAGAGCGGCCCCCGG + Intergenic
1142037138 16:87869361-87869383 TCTTCCTTCTCCTCGGCCGCCGG + Exonic
1142195770 16:88738684-88738706 GCTTCCTGCAGCCCTGCCGTCGG + Exonic
1202990348 16_KI270728v1_random:5175-5197 CCTGCCTGGGCCGCGGCCGCCGG + Intergenic
1203058481 16_KI270728v1_random:948521-948543 CCTGCCTGGGCCGCGGCCGCCGG - Intergenic
1142812288 17:2401002-2401024 GCCTCCCGCCCCGCGGCCCCCGG + Exonic
1143460443 17:7100536-7100558 GGATCCTGCACTGGGGCCGCAGG + Intergenic
1145787859 17:27605627-27605649 GCCGGGTGCACCGCGGCCGCTGG + Exonic
1147879776 17:43646155-43646177 GCTGCCTGCCCGGCGGCCTCTGG + Intronic
1148016949 17:44528390-44528412 GGATCCTGCACCGGGGCTGCAGG - Intergenic
1149916478 17:60614055-60614077 GGATCCCGCACCGGGGCCGCAGG - Intronic
1150682581 17:67295127-67295149 GGATCCTGCACCAAGGCCGCAGG - Intergenic
1151323697 17:73366262-73366284 GCTTCCGTCACTGCGGCAGCAGG - Intronic
1151567392 17:74906987-74907009 GGATCCTGCACCGGGGCCGCAGG + Intergenic
1152546784 17:81004212-81004234 GCTTCCCGCGCCGCCGCCCCGGG - Intronic
1157661896 18:49452774-49452796 GGATCCTGCACCAGGGCCGCAGG - Intronic
1157856833 18:51111787-51111809 GGATCCCGCACCGGGGCCGCAGG + Intergenic
1158282235 18:55840650-55840672 GCCTCCTGCACCAGGGCCGCAGG + Intergenic
1158460664 18:57643603-57643625 GGATCCTGCACCAGGGCCGCAGG + Intergenic
1159744032 18:72209544-72209566 GGATCCTGCACCGGGGCAGCAGG - Intergenic
1160083464 18:75753105-75753127 GCTGCCTGCCCCGCAGCAGCTGG - Intergenic
1160742703 19:694846-694868 GCTTCCTGCTGCGAGCCCGCTGG - Exonic
1161009456 19:1953284-1953306 GCTTCCTGCTCCGTGGCCCGGGG - Intronic
1161575509 19:5052419-5052441 GCTTCCTGCCCTGTGGCCGCAGG + Intronic
1161913419 19:7211716-7211738 GCTTCCTTCTCCGCGGCTGCCGG - Intronic
1162107072 19:8376181-8376203 GGATCCTGCACCGGGGCTGCAGG - Intronic
1162230219 19:9259930-9259952 GGATCCTGCACCGGGGCTGCAGG - Intergenic
1162814651 19:13186647-13186669 GTATCCTGCACCGGGGCTGCAGG + Intergenic
1163121941 19:15223540-15223562 TCTTCCGCCTCCGCGGCCGCCGG - Intergenic
1163719809 19:18893771-18893793 CCTCCCAGCACCGCGGCGGCCGG - Intronic
1165129170 19:33621693-33621715 GCTCCCACCCCCGCGGCCGCCGG + Intergenic
1165486420 19:36099448-36099470 GCTACCAGCCCCACGGCCGCTGG + Exonic
1165846654 19:38821884-38821906 GGATCCTGCACCAGGGCCGCAGG - Intronic
1165863227 19:38920026-38920048 GCTGCCTGCACCCCGACAGCTGG - Intronic
1166060355 19:40321855-40321877 GCTGCCTGCACCCCGCCCACAGG + Exonic
1166214680 19:41327543-41327565 GCTTCCTGCCCCACGGGGGCTGG + Intronic
1166358576 19:42242238-42242260 GCCTCCTCCGCCGCTGCCGCCGG + Exonic
927708487 2:25311317-25311339 GCTACCAGCACCCCTGCCGCAGG + Intronic
927942121 2:27111457-27111479 GGATCCTGCACCGGGGCCGCAGG + Intronic
928106426 2:28473048-28473070 GGATCCTGCACTGGGGCCGCAGG - Intronic
930468157 2:51780279-51780301 GGATCCTGCACCGGGGCTGCAGG + Intergenic
932983425 2:76698134-76698156 GCTTCTTGCATGGGGGCCGCGGG + Intergenic
933060769 2:77734723-77734745 GGATCCGGCACCGGGGCCGCAGG + Intergenic
933506386 2:83181416-83181438 GGATCCCGCACCGGGGCCGCAGG - Intergenic
933876128 2:86623386-86623408 CCCTCCTGACCCGCGGCCGCGGG - Exonic
936346963 2:111682267-111682289 GGATCCTGCACCGGGGCTGCAGG - Intergenic
936556780 2:113503440-113503462 GCGTCCTGCACCGGGGGCGGTGG - Intergenic
938126006 2:128672066-128672088 GGATCCTGCACCGGGGCTGCAGG + Intergenic
940215166 2:151296373-151296395 GGATCCTGCACGGGGGCCGCAGG - Intergenic
941164867 2:162074055-162074077 GCGTCCTGCACCGCTGCTCCGGG + Exonic
943790104 2:191922004-191922026 GGATCCCGCACCGGGGCCGCAGG - Intergenic
947931984 2:233972412-233972434 GGATCCCGCACCGCGGCTGCAGG + Intronic
1168983308 20:2026220-2026242 GCTGCCTGCCCCGCCGCAGCTGG - Intergenic
1169171713 20:3470883-3470905 GCCTCCGGCGCCGCGGACGCCGG + Intergenic
1171013760 20:21522454-21522476 GCTTCCTCCATCGCCACCGCCGG + Intergenic
1171724451 20:28603109-28603131 GCTTCCAGCCGCGCCGCCGCAGG - Intergenic
1172095231 20:32457162-32457184 GTTTCCTCCCCCGCGCCCGCAGG - Intronic
1172290116 20:33770021-33770043 GCTTCCTCCACTGCAGCCCCTGG - Intronic
1174136625 20:48384671-48384693 GCTTCCTTCACCGCTGGGGCCGG - Intergenic
1174354577 20:49989481-49989503 GCTTCCTGCTCCGAGGACGGCGG + Intergenic
1175743234 20:61435484-61435506 GCTTGGTGCACTGCGGCCGGAGG + Intronic
1176198170 20:63847553-63847575 GCTTCCCCCACCTCGGCCTCCGG - Intergenic
1176663292 21:9660418-9660440 GGATCCTGCACCAGGGCCGCAGG - Intergenic
1178054602 21:28784174-28784196 GGATCCTACACCGGGGCCGCAGG - Intergenic
1178314535 21:31557991-31558013 GCATCCCGCCCCGCGGCCGGGGG + Intronic
1180297997 22:10961783-10961805 GCTTCCAGCCGCGCCGCCGCAGG - Intergenic
1181077601 22:20392354-20392376 GGATCCCGCACCGGGGCCGCAGG + Intergenic
1182278656 22:29205909-29205931 GTTTCCAGCTCCGCGGCCGGAGG - Exonic
1182429017 22:30289384-30289406 TCTTCCTGCCCCGCCGCAGCCGG - Exonic
1183931398 22:41237978-41238000 TCTTCCTGCGCCGCGTCCCCAGG + Exonic
1185229044 22:49670150-49670172 GGATCCTGCACCGAGGCTGCAGG + Intergenic
1203289273 22_KI270735v1_random:17872-17894 GCTTCTTGCCCCGCCGCCGCGGG - Intergenic
949896277 3:8769226-8769248 GCTACCTGCACCGAGTCCGCAGG + Exonic
950600311 3:14029439-14029461 GGATCCTGCACCGGGGCTGCAGG + Intronic
951024780 3:17817616-17817638 GGATCCTGCACAGGGGCCGCAGG + Intronic
951185037 3:19702944-19702966 GGATCCTGCACCAGGGCCGCAGG - Intergenic
952453767 3:33453873-33453895 GCTTCCTGCACTGGGGCCGCAGG - Intergenic
953002963 3:38951568-38951590 GGATCCCGCACCGGGGCCGCAGG - Intergenic
953673996 3:44986060-44986082 GGATCCTGCACTGGGGCCGCAGG + Intronic
954230512 3:49213481-49213503 GGATCCTGCACTGGGGCCGCAGG + Intronic
955923469 3:63982366-63982388 GCTTCCTGCACCGCCCACTCTGG + Exonic
956195813 3:66651944-66651966 GGATCCTGCACCGGGGCTGCAGG - Intergenic
956632672 3:71331514-71331536 GGATCCCGCACCGGGGCCGCAGG - Intronic
960096756 3:113696674-113696696 GCTTGCTGAGCTGCGGCCGCGGG - Intergenic
960761593 3:121078475-121078497 GGATCCTGCACCAGGGCCGCAGG + Intronic
963589918 3:147245548-147245570 GGATCCTGCACCGGGGCTGCAGG + Intergenic
963750614 3:149175607-149175629 GATTCCTGCACTGTGGCTGCAGG - Intronic
964993439 3:162844559-162844581 GGATCCTGCACTGGGGCCGCAGG + Intergenic
966190939 3:177271671-177271693 GGATCCTGCACCGGGGCTGCAGG + Intergenic
968570892 4:1340232-1340254 GCTTCTGGCACCACGGCCACCGG + Intergenic
968583697 4:1406333-1406355 GCTTCCTGGGCAGCGGCGGCGGG + Intergenic
968636724 4:1684621-1684643 GCGTCCTGCCCCGCCGCCTCAGG - Intergenic
968850569 4:3074975-3074997 GCTTCCTCAGCCGCCGCCGCAGG + Exonic
971905117 4:32716168-32716190 GGCTCCTGCACCGGGGCTGCAGG + Intergenic
972360871 4:38324862-38324884 GGATCCTGCACCAGGGCCGCAGG + Intergenic
973039867 4:45457060-45457082 GGATCCTGCACCGGGGCTGCAGG + Intergenic
973041732 4:45477294-45477316 GGATCCTGCACCGGGGCCGCAGG + Intergenic
973854178 4:54993887-54993909 GGATCCTGCACCGGGGCCACAGG - Intergenic
977606845 4:98993424-98993446 GGTTCCCGCACTGGGGCCGCAGG + Intergenic
977906551 4:102483546-102483568 GCATCCTGCACTGGGGCTGCAGG - Intergenic
978917906 4:114148523-114148545 GGATCCTGCACTGGGGCCGCAGG + Intergenic
980063324 4:128155458-128155480 GCTGCCTGCACTGCGGCCGGGGG - Intronic
982868728 4:160550051-160550073 GGATCCTGCACCGGGGCTGCAGG + Intergenic
984241768 4:177227508-177227530 GGATCCTGCACCGGGGCTGCAGG + Intergenic
984770639 4:183433562-183433584 GGATCCTGCACCGGGGCTGCAGG - Intergenic
985412034 4:189695632-189695654 GGATCCTGCACCAGGGCCGCAGG + Intergenic
985437029 4:189940557-189940579 GCTTCCAGCCGCGCCGCCGCAGG + Intergenic
986330859 5:6714750-6714772 GGTGTCTGCACCGCGGGCGCCGG - Intronic
987071598 5:14342136-14342158 GCTTCTTGCACTGGGGCCGGGGG + Intronic
987383936 5:17311716-17311738 GGATCCTGCACCGGGGCTGCAGG + Intergenic
988154980 5:27439393-27439415 GGATCCTGCACCGGGGCTGCAGG + Intergenic
994251437 5:97541819-97541841 GGATCCTGCACCAGGGCCGCAGG + Intergenic
995596384 5:113753061-113753083 GGATCCTGCACCGGGGCTGCAGG + Intergenic
997013381 5:129904559-129904581 GCTGCCGCCACCGCCGCCGCCGG + Exonic
999248457 5:150167579-150167601 GGGTCTTGCTCCGCGGCCGCAGG - Intronic
999395456 5:151224042-151224064 GCTGCCCGCTCCGCGCCCGCCGG + Exonic
999824478 5:155260866-155260888 GCTGCCTGCACTGCGGGAGCTGG + Intergenic
1003593782 6:7456737-7456759 GCATCCCGCACCCGGGCCGCAGG - Intergenic
1003921578 6:10838210-10838232 GCCTCCTGGACCGCGGGGGCCGG - Intronic
1003926390 6:10881768-10881790 GCTTCCTGCACCGCGGCCGCCGG + Exonic
1004200342 6:13541958-13541980 GGATCCTGCACCCTGGCCGCAGG - Intergenic
1004694254 6:18019619-18019641 GGATCCCGCACCGGGGCCGCAGG + Intergenic
1004906280 6:20239431-20239453 GGATCCGGCACCGGGGCCGCAGG - Intergenic
1005117644 6:22356341-22356363 GGATCCTGCACCAGGGCCGCAGG + Intergenic
1005766392 6:29015498-29015520 GGATCCTGCACCCGGGCCGCAGG - Intergenic
1007457416 6:41990752-41990774 GCTCCCTGCACCTCTGCCTCCGG + Intronic
1007484881 6:42174137-42174159 GCTTCCTCCACCTCTGCCACAGG + Intronic
1011974834 6:93283023-93283045 GGATCCCGCACCGGGGCCGCAGG - Intronic
1013410711 6:109881088-109881110 GGATCCTGCACCGGGGCTGCAGG + Intergenic
1013853303 6:114541792-114541814 GGATCCTGCACCAGGGCCGCAGG + Intergenic
1013960152 6:115889464-115889486 GGATCCTGCACTGGGGCCGCAGG - Intergenic
1014391817 6:120873325-120873347 GCTTCCTGCCCCATGGCAGCTGG + Intergenic
1014788548 6:125644871-125644893 GGATCCTGCACCGGGGCTGCAGG - Intergenic
1015799272 6:137044470-137044492 GCTTCCAGCCCCGGGGCTGCAGG - Intronic
1016067295 6:139697866-139697888 GGATCCTGCACCGGGGCTGCAGG + Intergenic
1016217277 6:141618632-141618654 GGATCCTGCACCGGGGCTGCAGG - Intergenic
1018696120 6:166393294-166393316 GGATCCTGCACCGGGGCCGCAGG + Intergenic
1022174074 7:27856998-27857020 GGATCCTGCACCAGGGCCGCAGG + Intronic
1023861865 7:44221457-44221479 GCTTCCTCCTCCCCGGCCTCCGG - Intronic
1026512416 7:71038013-71038035 GGATCCTGCACCGGGGCTGCAGG - Intergenic
1027674552 7:81142156-81142178 GGATCCCGCACCGGGGCCGCAGG - Intergenic
1027948445 7:84780743-84780765 GCTTCTTGCAGCGCAGCCTCGGG - Intergenic
1031902943 7:127429582-127429604 GGATCCTGCACCAGGGCCGCAGG - Intronic
1032086853 7:128888930-128888952 GCTTCGTGACCTGCGGCCGCCGG - Exonic
1033454869 7:141493527-141493549 TCTTCCTGGACTGCAGCCGCAGG - Intergenic
1033866573 7:145697355-145697377 GGATCCCGCACCGGGGCCGCAGG + Intergenic
1034418543 7:150977655-150977677 GCTTGGTGCACCGGGGCCGTGGG - Intronic
1034691425 7:153017401-153017423 GCTGCATGCAGCCCGGCCGCTGG - Intergenic
1035325486 7:158062987-158063009 GGATCCTGCACCAGGGCCGCAGG - Intronic
1036915050 8:12796681-12796703 GGATCCTGCACCGGGGCTGCAGG - Intergenic
1039068808 8:33632098-33632120 GAATCCTGCACCGGGGCCGCAGG - Intergenic
1040351345 8:46571943-46571965 GGATCCTGCACTGGGGCCGCAGG - Intergenic
1040391571 8:46954914-46954936 CCTCCCTGCACCGCAGTCGCTGG - Intergenic
1040794237 8:51271652-51271674 GGATCCTGCACTGGGGCCGCAGG - Intergenic
1040952954 8:52954227-52954249 GATCCCTGCACCAGGGCCGCAGG - Intergenic
1041068608 8:54104613-54104635 GGATCCTGCACTGGGGCCGCAGG - Intergenic
1041166996 8:55101415-55101437 GCTGCCTCCACCGAGGGCGCTGG + Intergenic
1043073269 8:75665408-75665430 GGATCCCGCACCGGGGCCGCAGG + Intergenic
1043701192 8:83290768-83290790 GGATCCTGCACCGGGGCTGCAGG - Intergenic
1044075895 8:87821252-87821274 GGATCCTGCACCGGGGCTGCAGG - Intergenic
1045520564 8:102899471-102899493 GCTTCCTACACTGCTGCTGCAGG + Intronic
1048186820 8:132249601-132249623 GGATCCTGCACCGGGGCCACAGG + Intronic
1049426811 8:142541421-142541443 CCTTCCTGCATCGCTGCCCCTGG - Intronic
1049828614 8:144685814-144685836 GCGTCCTCCGCCGCCGCCGCCGG + Intergenic
1050892074 9:10836374-10836396 GGATCCTGCACGGGGGCCGCAGG - Intergenic
1052075519 9:24135484-24135506 GGGTCCTGCACCGGGGCTGCAGG - Intergenic
1052757101 9:32552288-32552310 GCTTCGTGCAGCGCTGTCGCTGG - Intronic
1052971733 9:34380910-34380932 GCTCCCGGCACCAAGGCCGCAGG + Exonic
1053690600 9:40584894-40584916 GCTGCCTGCACCGGGGGCGGGGG + Intergenic
1054301857 9:63385865-63385887 GCTGCCTGCACCGGGGGCGGGGG + Intergenic
1055397452 9:75890772-75890794 GCTGCCTGTACCGCTCCCGCTGG + Exonic
1055985454 9:82054324-82054346 GGATCCTGCACCGGGGCCACAGG + Intergenic
1057726982 9:97574591-97574613 GGATCCTGCACCGGGGCCGCAGG - Intronic
1058174797 9:101724058-101724080 GGATCCTGCACCGGGGCTGCAGG + Intronic
1058786570 9:108393930-108393952 GGATCCTGCACCGGGGCTGCAGG - Intergenic
1059556928 9:115290804-115290826 CCTTCCTGCACCCCTGCAGCTGG + Intronic
1060051559 9:120382185-120382207 GCTTCCTTCACCCAGGCCGGAGG + Intergenic
1060700615 9:125746968-125746990 GCTGCCTCCCCCGGGGCCGCCGG + Intergenic
1061006427 9:127930790-127930812 GATTCCTGCAGCGGGGCGGCGGG - Exonic
1061510759 9:131059664-131059686 GCTTCCTCCACAGGGGCTGCAGG - Intronic
1061859535 9:133460761-133460783 GCTCACTGCCCCGCGGCCCCAGG - Intronic
1062008086 9:134251559-134251581 GCTCCCGGCCCCGGGGCCGCTGG + Intergenic
1062060310 9:134491937-134491959 ACCTCCTGCACCGTGGCCGGAGG - Intergenic
1062250323 9:135590656-135590678 GCTCCCTGCACCTGGGCAGCCGG - Intergenic
1203662806 Un_KI270753v1:61347-61369 GGATCCTGCACCAGGGCCGCAGG + Intergenic
1203670560 Un_KI270755v1:7349-7371 GGATCCTGCACCAGGGCCGCAGG - Intergenic
1186295582 X:8144914-8144936 GGATCCTGCACTGGGGCCGCAGG + Intergenic
1186394729 X:9196044-9196066 GCTTTCTGCACTGAGGCCACAGG + Intergenic
1186509785 X:10122066-10122088 GCTTCCTCCCCCGGGGCCGCAGG + Intronic
1186865502 X:13717135-13717157 GCTTCCTGCACAGTGGCACCAGG + Intronic
1189896776 X:45664761-45664783 GGATCCTGCACCATGGCCGCAGG + Intergenic
1190321891 X:49184624-49184646 GCTTCCTGCTCCACGGCTGGAGG - Exonic
1190413896 X:50163275-50163297 GGATCCTGCACCGGGGCTGCAGG + Intergenic
1190687756 X:52889577-52889599 GCTTCCTTCACAGCTGCCCCTGG + Intergenic
1190698226 X:52966215-52966237 GCTTCCTTCACAGCTGCCCCTGG - Intronic
1198300055 X:135325871-135325893 GGATCCTGCACCGGGGCTGCAGG - Intronic
1198468173 X:136921780-136921802 GGATCCTGCACCGGGGCCGCAGG - Intergenic
1198664246 X:139003969-139003991 GGATCCTGCACCGGGGCTGCAGG + Intronic
1199831211 X:151551130-151551152 GGATCCTGCACCGGGGCTGCAGG + Intergenic
1199831728 X:151555135-151555157 GGATCCTGCACCGGGGCTGCAGG + Intergenic