ID: 1003926898

View in Genome Browser
Species Human (GRCh38)
Location 6:10884640-10884662
Sequence GTTCGCTGGTCCGCTGCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 32}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003926898_1003926902 -6 Left 1003926898 6:10884640-10884662 CCAGTGGCAGCGGACCAGCGAAC 0: 1
1: 0
2: 0
3: 5
4: 32
Right 1003926902 6:10884657-10884679 GCGAACTCTGTTGGGAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003926898 Original CRISPR GTTCGCTGGTCCGCTGCCAC TGG (reversed) Intronic
903882615 1:26521894-26521916 GTTCGCCGCTCTCCTGCCACCGG - Intergenic
906411686 1:45584118-45584140 GTTCGCTGGTTCGCCACCTCAGG + Exonic
908602954 1:65761187-65761209 ATTCGCTGGTCCTCTGCTCCCGG + Intergenic
1070129414 10:73646716-73646738 GTTCACTGGTGCCCTGCCCCAGG + Exonic
1075792807 10:125097553-125097575 GTTCTCTGTCCCGCTGCTACAGG + Intronic
1076167612 10:128294874-128294896 GTTCTCTGGTCTCCTGCCACTGG - Intergenic
1078667621 11:13339630-13339652 GGTCGCTGGTCCCCTAGCACTGG + Intronic
1079451208 11:20601276-20601298 GTGCCCAGGTCCGCTTCCACCGG + Exonic
1083811360 11:65108580-65108602 GGGCGCTGGACCGCTTCCACCGG + Exonic
1096523840 12:52199066-52199088 GTTCACTGTTCTGTTGCCACCGG + Intergenic
1104862012 12:131928943-131928965 GTTGCCGGGTCCGCTCCCACGGG - Intergenic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1123721977 15:23068235-23068257 GTTCGCTAGGCCTCTGCCTCCGG + Intergenic
1131842254 15:96449963-96449985 GTTCTCTGGTCTGCTGGCGCAGG + Intergenic
1142396894 16:89837237-89837259 GTTCCCTGGTCTGCTGCTGCAGG + Intronic
1146549651 17:33769339-33769361 GTTGGCTGCTCTGCTGACACAGG - Intronic
1150489099 17:65562050-65562072 GTTGGCTGGCCCGCTGTCATAGG + Intronic
1152243238 17:79170944-79170966 GTTCACAGATCCACTGCCACAGG + Intronic
1163274861 19:16277144-16277166 GTTCACTGGTCCCCTGTCAGGGG + Intergenic
938933764 2:136110858-136110880 GTTCCCTGATGAGCTGCCACAGG - Intergenic
943126743 2:183803811-183803833 GTTGGCTGGCCTGCTGCCAGTGG + Intergenic
946329160 2:219000123-219000145 CTCCGCTGCTCCGCTGCCACAGG - Intergenic
1175883382 20:62273344-62273366 GTTTGCCGGTCCTCTCCCACTGG - Exonic
1181562542 22:23714362-23714384 GTTCGCTGGGCCCTTGCCATGGG + Intergenic
953383779 3:42493250-42493272 GTAGGCTGGTGCCCTGCCACTGG - Intronic
953423451 3:42772831-42772853 GTTTGCTGGGCCTCTGCCACTGG - Intronic
964304721 3:155327590-155327612 GCTCCCTGGTCCCCTGCCTCTGG + Intergenic
972274224 4:37541929-37541951 GTTGCCTAGTCCGCTACCACTGG - Intronic
974040912 4:56856765-56856787 CTCCGCTGGACCGCTCCCACAGG + Intergenic
978282858 4:107037336-107037358 GCTCGCTGAACGGCTGCCACTGG - Intronic
984779386 4:183510565-183510587 TTTCACTGGTCCGCTGCCTGCGG - Exonic
985902321 5:2806252-2806274 GTTCGCTGGGCTGCTGGCACTGG + Intergenic
1003926898 6:10884640-10884662 GTTCGCTGGTCCGCTGCCACTGG - Intronic
1006162404 6:32046279-32046301 GTGCGCTGGTCTGCGGCCACAGG + Intronic
1006167517 6:32073751-32073773 TCTCGCTGGTCTGCCGCCACCGG + Intronic
1011415012 6:87109377-87109399 CTTCTCTGGTCTGCTGCCATGGG + Intergenic
1052809420 9:33044263-33044285 GTTCGCGCAGCCGCTGCCACCGG + Exonic
1199283467 X:146029867-146029889 GTTGGCTAGTGCCCTGCCACTGG - Intergenic