ID: 1003929465

View in Genome Browser
Species Human (GRCh38)
Location 6:10909686-10909708
Sequence TACGGCCAACTTTCCTTTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 98}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003929465_1003929472 26 Left 1003929465 6:10909686-10909708 CCCAAAAAGGAAAGTTGGCCGTA 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1003929472 6:10909735-10909757 ACATTTTGTAGGTTTGTGGTTGG 0: 1
1: 0
2: 2
3: 22
4: 315
1003929465_1003929470 15 Left 1003929465 6:10909686-10909708 CCCAAAAAGGAAAGTTGGCCGTA 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1003929470 6:10909724-10909746 TCACAGTTAATACATTTTGTAGG 0: 1
1: 0
2: 1
3: 24
4: 248
1003929465_1003929471 22 Left 1003929465 6:10909686-10909708 CCCAAAAAGGAAAGTTGGCCGTA 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1003929471 6:10909731-10909753 TAATACATTTTGTAGGTTTGTGG 0: 1
1: 0
2: 2
3: 35
4: 367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003929465 Original CRISPR TACGGCCAACTTTCCTTTTT GGG (reversed) Intronic
904283424 1:29437340-29437362 TTTGGCCAATTTTTCTTTTTTGG + Intergenic
904759189 1:32789409-32789431 TACAGCCATTTTTCCTTTTTAGG + Intronic
906899411 1:49817249-49817271 TCAGGCCAACTTTCTTTTTAAGG - Intronic
909151758 1:72015462-72015484 TATGTACAACTTTCCTCTTTAGG + Intronic
914713438 1:150235287-150235309 TGCGGCCAACTCATCTTTTTAGG - Intronic
915758430 1:158286392-158286414 TACCTCCACCCTTCCTTTTTAGG + Intergenic
923844111 1:237709261-237709283 AACGGCCAACTTTGATTTTAAGG - Intronic
1063637018 10:7792099-7792121 TTTGGTCAACCTTCCTTTTTTGG - Intronic
1068870251 10:61935698-61935720 TACAGTAAAATTTCCTTTTTTGG - Intronic
1069070374 10:63985770-63985792 TAGGGCCAACTTCCCTTTACTGG - Intergenic
1071093682 10:81949001-81949023 TATGGACAACTTTACTTTTCTGG + Intronic
1073421715 10:103429304-103429326 TACTGCCAACCCTTCTTTTTTGG + Intronic
1078601249 11:12733141-12733163 TACTACCCACTTACCTTTTTGGG + Intronic
1082228415 11:49735727-49735749 AACGACCAACTATTCTTTTTAGG + Intergenic
1086144772 11:83539600-83539622 TTCTGCCAAATTTTCTTTTTAGG - Intronic
1086621653 11:88893425-88893447 AACGACCAACTATTCTTTTTAGG - Intronic
1091806678 12:3361876-3361898 TCTGCCCACCTTTCCTTTTTGGG + Intergenic
1098446700 12:70573453-70573475 AACTGCCACCTTTACTTTTTAGG - Intronic
1103954536 12:124568776-124568798 TCAGTTCAACTTTCCTTTTTTGG + Intergenic
1106794335 13:33188921-33188943 TCCGGCTAACTTTGCTTTCTAGG + Intronic
1111411622 13:87884668-87884690 TACCTCCAACTTACCTTATTTGG + Intergenic
1111510331 13:89253473-89253495 TAAGGCCAACTTTCCTTTGGAGG + Intergenic
1113419140 13:110156186-110156208 TACAGGCAACTTTTCTTCTTTGG + Intronic
1115317404 14:32039538-32039560 CAAGCCCATCTTTCCTTTTTAGG - Intergenic
1116020721 14:39457125-39457147 TATGGTCATCTTTTCTTTTTTGG + Intergenic
1116111087 14:40583472-40583494 TACTCCCATCTTTCCATTTTAGG - Intergenic
1116802316 14:49455649-49455671 TACGGGCTGCATTCCTTTTTGGG - Intergenic
1120557943 14:85953705-85953727 TCCGGCCAACTTTCCCATTAAGG + Intergenic
1123691154 15:22839008-22839030 TTCGGGCAACTTTCCTTTCCGGG + Intronic
1124868958 15:33521774-33521796 TGCAGCCAACTTTCTTTTCTGGG + Intronic
1129786384 15:78312976-78312998 TTCGGCCAATTTTTTTTTTTTGG + Intergenic
1130401990 15:83565801-83565823 TAAAGCCACCTTTCCTTTTTAGG + Intronic
1130863947 15:87915982-87916004 TACCTCCAACTTTGCTCTTTGGG + Intronic
1137786257 16:51140190-51140212 CAAGGCCAAGTTTCCTTTTGGGG - Exonic
1144078412 17:11739780-11739802 TTGGGCCAACTTTTCTTTTCTGG - Intronic
1144454337 17:15406624-15406646 AAAGGCCAACTTTGCTTTTAGGG - Intergenic
1147799254 17:43071395-43071417 TAATGCCATATTTCCTTTTTAGG - Intronic
1153015962 18:582841-582863 TGGGGCCCCCTTTCCTTTTTTGG - Intergenic
1156591384 18:38493033-38493055 TATGTCCAACTTTCCTTTTAGGG - Intergenic
1164244291 19:23416972-23416994 AATGGCCAACTGTCCTTTGTGGG + Intergenic
1164717865 19:30406634-30406656 TACGGCCAGTTTTCCTTTTAAGG + Intronic
1167401536 19:49274540-49274562 CCCGGCCAGATTTCCTTTTTTGG + Intergenic
925368175 2:3325133-3325155 TCTCGTCAACTTTCCTTTTTGGG - Intronic
928822568 2:35379579-35379601 TATGGTAAATTTTCCTTTTTTGG + Intergenic
932087006 2:68771505-68771527 TTTGACCAACTTTCCTTGTTAGG - Intronic
934925130 2:98376942-98376964 TACGGGCACCTGTCCTTTCTGGG + Intronic
935849572 2:107203999-107204021 TAAGGCTAACTTTCATGTTTTGG + Intergenic
937090684 2:119204462-119204484 TCAGACCAACTTTCCTCTTTCGG + Intergenic
938366920 2:130742044-130742066 TACTGCTAACTTTTCTTTTCCGG - Intergenic
943040046 2:182793607-182793629 TGCTGCCAACTTGCCTTATTTGG - Exonic
943337815 2:186640075-186640097 CATTGCTAACTTTCCTTTTTTGG + Intronic
1172011355 20:31847881-31847903 TTCGGCCAAGTTCCCTGTTTTGG + Intronic
1177268885 21:18820355-18820377 TAAGGCCAGATTCCCTTTTTTGG - Intergenic
956521339 3:70107459-70107481 TAATCCCAACTTTCCTTTCTAGG - Intergenic
958131522 3:89431793-89431815 TATGGACAACTTTTCTTTATAGG - Intronic
962414924 3:135173362-135173384 TATGGTCTACTTTCCTTCTTTGG + Intronic
966334344 3:178851599-178851621 TACAGTCATCTTTTCTTTTTAGG - Intergenic
966445452 3:179996789-179996811 TACGCCCACCTTGCCTTTGTTGG - Intronic
966464708 3:180217089-180217111 TACTGCCAACTTCCAGTTTTTGG + Intergenic
969229450 4:5819691-5819713 TCCTGCCAACTTTACTTTTCTGG + Intronic
971524311 4:27597063-27597085 AACGGCCAATTTTACTTTATGGG + Intergenic
972016351 4:34250828-34250850 TAGGGGCAATTTTCCTTTATTGG + Intergenic
974573782 4:63689597-63689619 TTTGGCCAACTTTTCTCTTTTGG + Intergenic
976146306 4:82044856-82044878 TACAGTCACCTTTCCTCTTTTGG - Intergenic
979228725 4:118321744-118321766 TTCCCCCAACTTTACTTTTTGGG - Intronic
980472956 4:133273438-133273460 TACGGGAAACTGTCCATTTTTGG + Intergenic
983000357 4:162407236-162407258 TAATGCAAACTTTCCTTCTTAGG + Intergenic
993352095 5:86862646-86862668 TTCTGCCAACTTTTCTTTTTGGG + Intergenic
995677994 5:114684965-114684987 GCCTCCCAACTTTCCTTTTTTGG - Intergenic
996248640 5:121298754-121298776 TAATGCCAACTTACTTTTTTTGG - Intergenic
996545839 5:124678206-124678228 CATTGCCAGCTTTCCTTTTTTGG - Intronic
999139069 5:149345526-149345548 TACGGCCATGTTTCCAATTTGGG - Exonic
1003929465 6:10909686-10909708 TACGGCCAACTTTCCTTTTTGGG - Intronic
1004929571 6:20449079-20449101 TACTACGTACTTTCCTTTTTTGG + Intronic
1008385200 6:50881113-50881135 TACAACCAACTTTTTTTTTTTGG + Intergenic
1010535722 6:77027157-77027179 TAAGGCAATCTTTCCTTCTTAGG + Intergenic
1015601544 6:134915724-134915746 TATGATCCACTTTCCTTTTTTGG + Intergenic
1016722517 6:147318528-147318550 TATGGCCATCTTTCTTGTTTGGG + Intronic
1020635574 7:10692308-10692330 AAGGGCAAAGTTTCCTTTTTAGG + Intergenic
1022166438 7:27768141-27768163 TAAAGCCAACTGTCCTTATTAGG + Intronic
1023485039 7:40677222-40677244 TTCGGCCAACTCTACATTTTAGG + Intronic
1026473545 7:70714744-70714766 TACGGCCAACTTCCATTTACAGG - Intronic
1031676329 7:124616565-124616587 TACGCCCACCTTTCCTTTGATGG - Intergenic
1032988773 7:137367275-137367297 TGGTACCAACTTTCCTTTTTTGG + Intergenic
1034111621 7:148542937-148542959 TCCAGCCAACTTTCCTCTTCAGG + Intergenic
1036279148 8:7384622-7384644 TAAGGACAACTTTGCCTTTTAGG + Intronic
1036342368 8:7927251-7927273 TAAGGACAACTTTGCCTTTTAGG - Intronic
1037480014 8:19295825-19295847 TAAGGGCTTCTTTCCTTTTTGGG + Intergenic
1040293078 8:46135427-46135449 TGCGGCCACGTTTCCTTTGTGGG + Intergenic
1040567340 8:48579551-48579573 TAGGGCCAACTTTAGATTTTAGG - Intergenic
1045503950 8:102765244-102765266 TCAGGCCAACTTTTCTTATTAGG - Intergenic
1046620328 8:116522349-116522371 TACAGCAAACTTTCTTTTTTTGG - Intergenic
1048912552 8:139149957-139149979 TACTGCCTCCTTTCATTTTTAGG - Intergenic
1057116181 9:92524511-92524533 AACTGCCAACCTTCCTTTGTAGG - Intronic
1057352103 9:94307659-94307681 TACTGCCAACTTCCCTCTATAGG - Intergenic
1057655539 9:96948431-96948453 TACTGCCAACTTCCCTCTATAGG + Intronic
1185979494 X:4761052-4761074 TAAGGACAACTTTCCATGTTAGG - Intergenic
1187566764 X:20458136-20458158 TAAAGCCAAATTTCCTTTTGAGG - Intergenic
1188740723 X:33776921-33776943 TATTGCCACCTTTGCTTTTTTGG + Intergenic
1189700340 X:43712098-43712120 TACGACCAACTTTGCAGTTTGGG - Intronic
1190628527 X:52361461-52361483 TAAAGACAATTTTCCTTTTTAGG - Intergenic
1191193393 X:57691449-57691471 TTCTTCCAACTTTACTTTTTTGG + Intergenic
1194773297 X:97931225-97931247 TAGGACCAACTTTTCTTTTCTGG - Intergenic
1195894881 X:109735321-109735343 TATTTCCAGCTTTCCTTTTTCGG + Intergenic
1195933018 X:110097927-110097949 TACAGCCAAATTGGCTTTTTTGG + Intronic
1198423905 X:136496690-136496712 AAGGGCCAACTTTCTTTTTCTGG - Intergenic