ID: 1003929542

View in Genome Browser
Species Human (GRCh38)
Location 6:10910580-10910602
Sequence TGGGAATCTGGCTGAGTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003929537_1003929542 17 Left 1003929537 6:10910540-10910562 CCTTGGTCAGACAATATTTGCTA 0: 1
1: 0
2: 0
3: 13
4: 165
Right 1003929542 6:10910580-10910602 TGGGAATCTGGCTGAGTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003929542 Original CRISPR TGGGAATCTGGCTGAGTAAC TGG Intronic
No off target data available for this crispr